صفحة 1 من 3 123 الأخيرةالأخيرة
النتائج 1 إلى 15 من 45

الموضوع: مناظرتي مع الملحد هشام آدم والتي انتهت بانسحابه

  1. #1

    Exclamation مناظرتي مع الملحد هشام آدم والتي انتهت بانسحابه


    مناظرة مع الملحد هشام آدم بعنوان : وجود الله ..

    الجزء 1 ...
    جرت هذه المناظرة في جروب (نقاش فكري) على الفيسبوك ..
    وقد انتهت بانسحاب الملحد بأعذار أني أخطأت ولفقت ودلست فيها .. ولله الحمد ..!
    ---------

    مقدمة الجروب للمناظرة .. وبيان شروطها :

    بسم الله الرحمن الرحيم ,,
    والصلاة والسلام علي رسوله الامين ,,
    وبعد ,,, ايمانا منا بالحوار كقيمة حضارية راقية ,,تنشر الوعي بين الناس بمختلف توجهاتهم ,, وتنير الدروب للحقيقة ,, وسعيا للتلاقي النبيل علي طريق المعرفة ,, نعلن عن هذه المناظرة الاولي بعنوان (وجود الله) بين الاستاذ هشام ادم ,, والمهندس عبد الدائم نوري (تم استبداله بالمهندس أبو حب الله لضمان نزاهة المناظرة) ,, وانا بين يدي هذه المناظرة اجد نفسي في موقف لا احسد عليه ,, اذ كيف اقدم مناظرة بهذا العنوان ,, وانا تنتابني هذه المشاعر الغريبة ,, وانا احاول الضغط علي مشاعر المؤمن ليبدو محايدا ( فنيا ) في ادارة مثل هذه الحوارات ,, لكنه يحدوني الامل ان اساهم في ايصال مشاعل الحقيقة ,,من خلال هذا الموقع الهام ,, وكل امالنا ان يكون الحق مطلب المتحاورين ,, والحقيقة غايتنا جميعا ,,,
    عليه ادعو الجميع لمتابعة هذا الحوار الجاد ,, في قضية تمثل مبرر وجودنا في الحياة ,, بنفس القدر من الاهتمام ,, والانضباط ,, وسوف تبدا المناظرة يوم الخميس السابع من فبراير ,,الساعة الرابعة بتوقيت السودان ,, ومن علي هذا الموقع ( نقاش فكري ) .

    تجدون ادناه شروط المناظرة :

    1- الإلتزام بأداب الحوار وعدم سب المقدسات الإسلامية أو التنابذ الشخصي ,, وجعل الفكرة هي التي تصارع الفكرة .

    2- عدم الخوض في قضايا خارج موضوع المناظرة ,, مثل اثارة الشبهات حول الاسلام او رسولنا الكريم عليه افضل الصلوات والتسليم .

    3- فى حالة الاقتباس يتم ذكر المصادر المعتمد عليها.

    4- لا يجوز لاي من المتحاورين ,, وضع أي روابط لأي منتدى أو جروب أو صفحة اثناء الحوار .

    5- كل مداخلة أقصى ميعاد للرد عليها أسبوع وإلا فسيعتبر المناظر منسحب من المناظرة ,, مالم يقدم عذرا مقبولا .

    6- لا يحق لكلا المتناظرين التعليق على بوست التعليقات فهو للمتابعين فقط ,, ليعلقوا على المناظرة.

    7- لكل مناظر مداخلة,, ويليه المناظر الآخر بالرد على مداخلته ,,ثم يتبعها إن شاء بمداخلة له وعلى الاخر بالمثل أن يرد على مداخلة المناظر ويليها بمداخلة له.

    8- يحق للطرفين أن يتفقا أثناء المناظرة على اى شروط اخرى بينهما ,, بشرط موافقة الادارة ,,وعدم الخروج عن موضوع المناظرة.

    9- يقوم بإدارة المناظرة طرف من اعضاء جروب (نقاش فكري) بحيادية ويمكنه أن يترك مكانه فى إدارة المناظرة لغيره ,,ولا يحق للمدير التدخل فى أي مداخلات إلا لتصحيح المسار ,, او اعادة صياغة بعض الحديث بموافقة صاحب الحديث .

    10- يحق لأي من طرفي المناظرة إنهاءها إن أراد في أي وقت ,,بشرط إعلان ذلك أمام الجميع ,,,ودون ابداء الاسباب ان اراد .

    تنبيهات :

    1) سيتم فتح بوست جديد لتعليقات الاخوة المتابعين .

    2) علي الاخوة المتابعين الالتزام بعدم التعليق في بوست المناظرة .

    3) ادارة الموقع هي المسؤولة عن ادارة المناظرة بكل الحياد التنظيمي .

    4) يدير المناظرة ابوذر الباقر ,, يساعده الاستاذ معزخضر ,,والاستاذة لبني ,, والاستاذ محمد النو ,, والاستاذ محمد علي .
    ---------------

    وأقول أنا أبو حب الله :
    سأقوم الآن بعرض وترقيم مداخلاتي في المناظرة وما جاء فيها ...
    مع استبعاد أي كلام جانبي ليس في أصل المناظرة .. واستبعاد مداخلات الملحد لعدم التطويل ..
    ويمكن الرجوع إلى أصل مداخلاتي ومداخلاته من الرابط التالي :
    http://www.facebook.com/groups/369738539778531/permalink/419593434793041/

    والتي بدأت رسميا
    7 فبراير 2013 :
    وانسحب الملحد هشام
    18 فبراير .. وكانت آخر مشاركاتي 21 فبراير ..

    أدعو الله تعالى أن يستفيد كل باحث عن الحق بحق مما سيقرأه ..

    مع العلم بأن الملحد السوداني هشام :
    هو من أشهر الملاحدة المثقفين - من المفترض - والمتمكنين من الترجمة ..
    وكان وقت المناظرة يعكف على ترجمة كتاب للدفاع عن خرافة التطور كما سنرى ..
    وهو كتاب :
    لماذا التطور حقيقة
    why evolution is true لكاتبه جيري كوينjerry coyne

    وعلى غرار ما فعله الملحد الآخر بسام البغدادي في ترجمته لكتاب داوكينز ..
    وهو يكتب في موقع إلحادي شهير - يساري علماني - ..
    وله تعليق هناك حاول فيه تبرير انسحابه من المناظرة أمامي ..
    وسوف أنقل في نهاية هذه المناظرة بإذن الله تعالى :
    تعليقات الإخوة على ما رماني به من تهمة التلفيق إلخ إلخ ..
    رغم أن ما انتقاه للتعليق على المناظرة الطويلة بيننا : لم يتعدى واحد من المائة فقط مما دار فيها !
    وكما سيرى كل متابع ... أو كما راسلني أحد الإخوة قبل انسحاب هشام بأيام (وهو الأخ عبد الدائم نوري) :
    أن هشام سيحاول الانسحاب لأنه ضعيف شرعيا ..لأنه إذا كان هذا هو حال فشله في المناظرة علميا :
    فالأفضل له الانسحاب قبل الوصول إلى الجانب الشرعي منها ..!
    كما أعتذر عن أي تقصير في التنسيق واكتظاظ الكتابة - هكذا هو الفيسبوك
    وقد قمت بتصحيح بعض الأخطاء الكتابية لي ..

    بالتوفيق ...
    ---------------

    1...
    الزميل هشام .. أنت تقول أنك لا ترى أدلة (قاطعة) على وجود الله تعالى : ثم طلبت أدلتي عن ذلك .. وهذا جيد .. وسوف ألبي لك طلبك بإذن الله .. ولكني قبل ذلك .. قد لمحت في كلامك جملة : لا يجب أن تمر مرور الكرام من غير أن أبين لك خطأها المنطقي
    أما هذه الجملة فهي أنك تقول (وبعد ذكرك أنك لا ترى أدلة على وجود الله) أنك لا تؤمن بوجود إله : لا يظهر للذين أمرهم بعبادته .. وهو قولك : "" لاسيما في حال كانت هنالك ضرورة لعبادته، فليس هنالك سبب لاحتجاب إله يفرض علينا عبادته ""
    أقول : وهذا أول خلط زميلي بين العقل والمنطق والعلم بوجود إله من جهة .. وبين عدم معرفتك لمراد ذلك الإله منك من الجهة الأخرى !!.. وإلا زميلي : أين هو معنى الاختبار بالإيمان : إذا كنت ترى الإله الحق فعلا أمامك ؟!!!.. أين معنى الاختبار هنا ؟؟!.. وهل هذا الإيمان : هو الإيمان الذي أراده الله تعالى منك يا إنسان : بعقلك الذي ميزك به : وبحرية اختيارك التي أودعها أياك ؟؟؟
    إذا زميلي هشام
    لا تخلط بين (الأدلة) على وجود إله ..
    وبين (مراد) هذا الإله منك وحقيقة امتحانه لك ...
    يقول الله تعالى في قرآنه في سورة الشعراء : " إن نشأ ننزل عليهم من السماء آية فظلت أعناقهم لها خاضعين "
    ويقول في سورة السجدة : " ولو شئنا لآتينا كل نفس هداها "
    ويقول في سورة يونس وبصورة أوضح : " ولو شاء ربك لآمن من في الأرض كلهم جميعا أفأنت تكره الناس حتى يكونوا مؤمنين "
    وغير ذلك ... إذا ً: مسألة ربط (أدلة) وجود الله تعالى بأنه (لم يظهر لنا) : هي غير صحيحة : لأنها تنافي مراده أصلا وامتحاننا الذي أخبرنا به
    هذه فقط كانت لفتة جانبية لعل زميلي هشام يراجعها في كلامه أو بينه وبين نفسه : وربما عدنا إليها مرة أخرى ..
    أما الآن .. وحتى لا أطيل على الزميل هشام .. فسوف أعرض عليه مجموعة من الأدلة على وجود الله تعالى .. وعليه فقط أن يختار من بينها : أيها يحب البدء به ..
    سأذكرها مختصرة وبأرقام حتى يستطيع الاختيار بينها بذكر الرقم .. ثم أعلن انتهاء مداخلتي - وليعذرني على الإطالة إن رآني أطلت بلا داعي - ليتفضل هو بالكلام ..
    وأما من أبرز الأدلة على وجود الله تعالى هي :
    1-
    دليل أن كل حادث لم يكن موجودا من قبل : فله محدث (بضم الميم وكسر الدال) .. وإذا تعللنا بهذه العلة إلى ما لا نهاية من غير أن يكون هناك محدث أزلي أصلي الوجود (أي وجوده هو أصل الوجود وليس العدم هو الأصل) : فهذا من الاستحالة بمكان .. وهذا ما سأبين سببه وقتها إذا اختار مناقشة الزميل هذا الدليل ..
    2-
    الدليل الثاني هو دليل الإحكام في الخلق .. والقدرة والإرادة والغائية في كل المخلوقات وأعضاءها إلخ إلخ .. وهو ما يستحيل أن يولد نتيجة الصدفة .. وسأترك بيان ذلك أيضا لوقته إذا اختار الزميل هذا الدليل ..
    3-
    وهو دليل التذليل للإنسان حيث نرى كل ما حول الإنسان وقد أعد له ولحياته على الأرض بصورة كاملة الدقة لا يمكن تخيلها .. من أصغر الأشياء في الأرض إلى أكبرها .. وهو ما يتوافق مع تميز الإنسان من بين المخلوقات بالعقل .. وتميزه بالرسالات السماوية ..
    4-
    دليل اتفاق الرسالات الكبرى على وجود إله وتوحيده .. وبيان أن الأصل في الإنسان كان هو عبادة إله واحد : إلا ما استحدثه البشر من الشرك بالله .. وكما حكاه الله تعالى في قصة نوح عليه السلام .. وهذا الدليل باختصار : يقوده الإسلام وصدق نبي الإسلام فيما أخبر به .. فإذا أردت أن تختار هذا الدليل زميلي : فيمكنني أن أناقشه معك - أي أدلة أن النبي محمد مرسل من خالق هذا الكون وإلهي وإلهك - وصدقه
    5-
    دليل الفطرة الإنسانية الظمآنة لمعاني أسمى من المادة : وتتعلق دوما بوجود إله .. ويلاحظ ذلك في الخواء الروحي والإنساني الذي يكتنف الملحد إذا أنكر الله تعالى : فصار بغير هدف في الحياة .. فساعتها تظهر الآلام النفسية الداخلية (أي سببها الفرد نفسه ولم يسببها أحد له) والقلق والتوتر مما قد يفضي لليأس والانتحار .. وكل هذا قد سمعناه وقرأناه ممن دخلوا دوامة الإلحاد - وسمعته وقرأته بنفسي عشرات المرات - سواء الإلحاد بمعنى إنكار وجود الله يقينا .. أو إنكاره بالشك ..
    6-
    وهو آخر دليل حتى لا أطيل عليك .. وهو دليل الهداية والغريزة .. واللذان يشملان الكائنات الحية : من أصغر بروتين في الخلية الحية وهداية الله تعالى له بكيف يتصرف في الحياة : إلى المخلوقات الحية ككل من طيور لأسماك لثدييات لزواحف لحشرات إلخ : إلى الحد الذي نرى معه العجب العجاب الذي لا تفسير له البتة في تصرفاتها إلا أنها قد هداها العليم الخبير : " الذي أعطى كل شيء خلقه ثم هدى "
    ---------------

    2...
    أولا : أعتذر عن التأخير للظروف التي ذكرت .. ثانيا : ومع رغبتي في مناقشتك فيما رددت به في مشاركتك عن مسألة استشهادي بالقرآن ومسألة الإيمان والعدل والرحمة إلخ إلخ .. إلا أني وكما قلت لك : لا أريد خلطا بين إنكار الإله أو الخالق لأسباب نفسية شخصية (من وجهة نظرك) وبين إنكار الإله أو الخالق لأسباب عقلية منطقية علمية بحتة .. وعليه .. فلن أشتت الترتيب المنطقي لحواري معك كملحد (يشكك) في وجود الله .. بل أختار أن نتحاور أولا في وجود الله .. حتى إذا انتهينا من حوارنا إلى نتيجة : انتقلنا لما بعدها .... ومن هنا أرجو منك الدقة فيما بعد بين وصفك لـ (الخالق) أو لـ (إله) .. فقد لاحظت ميلك للإيمان بوجود (خالق) ولكن اعتراضاتك أو تشكيكاتك قد تتوجه إلى الاعتراف بـ (ألوهية) هذا الخالق أي : اعتراضك أنه له رسل ورسالات وامتحان وأوامر ونواهي وعبدات إلخ .. فإذا كان هذا هو ميلك ومرادك بالفعل كما لمست أنا : فأرجو التوضيح بقولك مثلا ً: ((نعم أؤمن بوجود خالق)) ثم اختر ما تشاء بعدها للنقاش فيه أو تتركني لأختار .. وإن كان كلامي خطأ وأنك بالفعل (متشكك) في وجود (خالق) أصلا : فأرجو أيضا التوضيح : ثم يمكنك اختيار أي دليل من الأدلة الستة التي ذكرتها لك لنتناقش فيه أو تفنده لي إلخ .. ودعائي لك بالهداية إن شاء الله .. انتهيت

    ---------------

    3...
    حسنا أستاذ هشام .. فلتختر أيا من الأدلة الستة التي ذكرتها لك لنتناقش فيه حول وجود الخالق عز وجل .. ثم بعدها ننتقل للحديث عن الإله واعتراضاتك (العقلية والمنطقية) على ألوهيته .. وعن نفسي وطالما أنت تقول أنك لا ترى أي دليل على وجود خالق عاقل ومريد وله غاية إلخ : أرى أن نأخذ مثلا دليلين نتحاور فيهما .. دليل على استحالة تسلسل الحوادث إلى ما لا نهاية بغير محدث واحد أزلي قديم أول .. ثم دليل الإحكام في خلق الكون والكائنات .. هذا اقتراحي .. ولا ألزمك به بالطبع .. ولكن لك كل الاختيار في الموافقة عليه أو اختيار ما تريد من النقاط الستة .. في انتظار ردك واختيارك .. انتهيت

    ---------------

    4...
    من بعد إذن الأستاذ هشام .. سأقوم بتقسيم مداخلتي إلى 3 أجزاء .. لا لشيء إلا لأنها طويلة 16.180 حرف .. والحد الأقصى لحروف المداخلة في الفيسبوك 8.000 فقط .. أقول : قد قرأت ردك الذي كتبته أستاذ هشام وأقول : وأنا أيضا لم أت إلى هنا لأتناقش في المصطلحات .. وإنما ألزم نفسي بموضوع الحوار .. وتأكد أنك ستجدني دوما مباشرا في كلامي معك بدون التفاف .. فكم هي المصطلحات التي يغيرها أصحابها أو تتلون معهم على حسب المكان والزمان .. وليس المجال الآن لذكرها .. هذاأولا.....###...... وأما ثانيا: فالإسلام بالفعل يفرق بين الخالق - والأصح وصفه بالرب لأنه يتضمن مستلزمات الخلق من رعاية ورزق وهداية وفطرة وإلهام وغريزة إلخ - وبين معنى الألوهية : أي الإله المستحق للتوحيد والتفرد بالعبادة والطاعة والنسك إلخ .. والتقصير في فهم المعنيين أو عدم التفريق بينهما هنا هو من عوام المسلمين للأسف : والذين حتى لم يتدبروا القرآن نفسه : فضلا عن تعلم العلم الشرعي .. وأنا لن اطيل في هذه النقطة لأنها تحصيل حاصل لما ذكرته أنت .. ولكني أذكر فقط كل قاريء أن مشركي قريش في وقت النبي : كانوا يؤمنون بالله تعالى ربا وخالقا : ولا يؤمنون به إلها مستحقا للتفرد بالتوحيد والعبادة والطاعة والنسك !!.. فكانوا يعبدون أصنامهم ويشركون بها الله تعالى ويدعونها من دونه ويستقسمون الأزلام عندها ويذبحون لها إلخ إلخ إلخ .. يقول عز وجل في سورة العنكبوت : " ولئن سألتهم من خلق السماوات والأرض وسخر الشمس والقمر ليقولن الله فأنى يؤفكون " ؟!!.. والاستفهام الاستنكاري هنا هو لبعث التعجب في وعي القاريء أو السامع لهذا الكلام : أن كيف يصرف الكفار أو المشركون العبادة والألوهية : لغير خالقهم !!!.. ويقول كذلك في نفس السورة مستكملا نواحي الربوبية التي أخبرتك بها والتي هي أكبر من مجرد الخلق فقط : " ولئن سألتهم من نزل من السماء ماء فأحيا به الأرض من بعد موتها ليقولن الله قل الحمد لله بل أكثرهم لا يعقلون " !!.. وفي سورة الزخرف : " ولئن سألتهم من خلقهم ليقولن الله فأنى يؤفكون " ؟!!.. وأكتفي بهذا القدر في هذه النقطة........###......... ثالثا : أما بالنسبة لقولك أنك لا تجد أدلة منطقية أو علمية على وجود الخالق : بل هي (عندك) تستوي مع أدلة عدم وجود خالق عاقل إلخ .. أقول : هذا رأيك الخاص أستاذ هشام ولا يلزمنا في شيء إلا بالدليل .. وهذا ما نحن بصدد إثباته الآن .. إذ في الوقت الذي تقول أنت فيه ذلك : تتعجب مليارات البشر ممن ينفي وجود خالق ولا يرى أثار خلقه في مخلوقاته : هذا بالنسبة للعوام أنفسهم .. فما بالك والعلم في كل يوم يثبت وجود خالق حكيم قدير عليم خبير حسيب : قد أحسن كل شيء خلقه : من الأفلاك الكونية وما فيها : إلى أصغر خلية وذرة !!!.......###....... رابعا : بالنسبة لحديثك عن أزلية الخالق عز وجل والتي أراها (واجبة) عقلا ومنطقا .. في حين تقول أنت عنها : "" حسنًا .. السؤال البديهي الذي يطرح نفسه في هذه الحال (طالما أنَّ كل شيء لابد له من موجود) هو: وكيف أو من أوجد الله؟ هذا سؤال مُستهلك للغاية، أترك لك حرّية الإجابة أو عدم الإجابة عليه "" أقول : بل أجيب عليه .. وذلك بمثال صغير .. يمكنك التعليق عليه إذا أردت .. والمثال سنتصور فيه معا ً: جنديا ًينتظر أمر إطلاق النار من قائده .. وقائده : ينتظر أمر إطلاق النار من قائده .. وقائده ينتظر أمر إطلاق النار من قائده ....... وهكذا إلى ما لا نهاية .. فهل سيتم إطلاق النار ؟!!.. الإجابة هي لا !!!.. إذا ً: يستحيل تسلسل المسببات إلى ما لا نهاية وإلا : لم نكن لنرى شيء أصلا ًولا مخلوقات إلخ إلخ إلخ .. ومن هنا : وطالما أنا موجود وأنت موجود والكون موجود إلخ : فدل ذلك على تلقي الأمر الأولي بالفعل من ذات : ليس قبلها شيء !!.. ولا تعتمد على أمرها في شيء : أزلية ليست حادثة !.. ولذلك وصف الله تعالى نفسه في قرآنه باسم " الأول " .. وقال عنه رسولنا الكريم كما في الدعاء الشهير الذي رواه مسلم والترمذي وأبو داود وابن ماجه وأحمد : " أنت الأول فليس قبلك شيء " .. وكذلك أيضا ًوصفه الفلاسفة والمتكلمين بـ (واجب الوجود) و (العلة الأولى) إلخ .. إلى هنا : ويمكنك التعليق على هذه النقطة إذا أردت .. والهدف منها كما بينت : هو ليس إثبات وجود ((إله)) أزلي ولكن : ((خالق)) أزلي .. وبالنظر في كلامك بعدها ... واختيارك لأزلية (المادة) الغير عاقلة : لا أزلية (الخالق) الحكيم المريد المدبر العليم الخبير : فيمكنني تفنيد قولك هذا من جهتين الجهة الأولى وهي عدم أزلية المادة كما تعتقد .. والجهة الثانية وهي الإحكام المذهل لقوانين الكون منذ لحظة ولادته : بما يتعارض مع أن يكون الكون قد نتج عن مادة أزلية (غير واعية) !!!.. فأقول :

    ---------------

    5...
    ........###........ خامسا : المادة ليست أزلية : بل العلم الآن يثبت ظهورها فجأة منذ لحظة الانفجار الكبير Big Bang ..!! بمعنى آخر : أنت تتحدث عن فرضية قديمة للملاحدة أستاذ هشام .. وهي فرضية الكون الأزلي أو المادة الأزلية .. والتي انهارت بظهور أدلة الانفجار الكبير والضبط الكوني الرهيب عليها .. وهنا يجب الإشارة إلى مفهوم خاطيء عن الانفجار الكبير ينتشر بين العوام والغير متخصصين وهو : أن الانفجار كان انفجارا - مثل انفجار القنابل ونحوه - !!.. وأنه كان للمادة والطاقة فقط .. أقول : العلماء المتخصصين ينفون هذا التصور السطحي .. فالانفجار هنا يعني : الظهور المفاجيء .. وهو شبيه بوصفهم لفترة (الانفجار الكمبري) .. حيث يشيرون به إلى ظهور الكائنات الحية المعقدة مرة واحدة في السجل الحفري الزماني في فترة وجيزة جدا لا تتجاوز 5 ملايين سنة بجوار مليارات السنين !!.. يقول المختصون عن الانفجار الكبير (والذي كان ظهورا مفاجئا لحظيا للمادة والطاقة والزمان معا : أي الزمكان) : the Big Bang was NOT an explosion. We don't know what, exactly, happened in the earliest times, but it was not an explosion in the usual way that people picture explosions والمعنى التقريبي لمن لا يتقن الإنجليزية :

    " الانفجار الكبير : لم يكن انفجارا بالمعنى المفهوم .. نحن لا ندري بالضبط ماذا حدث في هذه الأوقات الأولى للزمن .. ولكنه في النهاية ليس انفجارا كما يتصوره الناس " !!.. أقول : سبحان الله العظيم .. فرغم المعلومات التي باتت دقيقة والأبحاث : إلا أنهم يجهلون الكيفية وما حدث بالضبط : ليصدق فيهم قول ربنا عز وجل في سورة الكهف : " ما أشهدتهم خلق السماوات والأرض ولا خلق أنفسهم وما كنت متخذ المضلين عضدا " !!.. ويؤكد هذا المعنى عن الانفجار الكبير وأنه لم يكن انفجارا بالمعنى الشائع : العالم Bill Bryson حيث يقول : Although everyone calls it the Big Bang, many books caution us not to think of it as an explosion in the conventional sense. It was, rather, a vast, sudden expansion on a whopping scale - المرجع : Bryson, B. (2004) A Short History of Nearly Everything, p. 31 والمعنى التقريبي لمن لا يعرف الترجمة : " على الرغم من أن الكل يسمونه الانفجار الكبير ..إلا أن العديد من الكتب تحذرنا من تصوره كانفجار بالمعنى المعروف .. فالحقيقة أنه : توسع عظيم ومفاجيء على نطاق ضخم " !!.. والآن أستاذ هشام : دعني أزيدك تاكيدا على أن المادة والطاقة والزمكان لم يكونوا معروفين قبل لحظة الانفجار الكبير أو ما يعرف بما قبل زمن بلانك (وهو يساوي جزء صغير جدا ًمن الثانية 10 أس -43) .. حيث نقرأ من الـ Models of Earlier Events ومن أحد أشهر المواقع الفيزيائية العالمية hyperphysics.phy-astr.gsu.edu الكلام القيم الواضح التالي :Before a time classified as a Planck time, 10^(-43) seconds, all of the four fundamental forces are presumed to have been unified into one force. All matter, energy, space and time are presumed to have exploded outward from the original singularity. Nothing is known of this period. والمعنى التقريبي لمَن يريد الترجمة : " أن الكون الذي نعرفه وتتبعه القوانين التي نعرفها اليوم : لم يكن له وجود قبل زمن بلانك !!!!.. وحتى القوى الأربعة (وهي قوى الجاذبية والكهرومغناطيسية والنووية الضعيفة والنووية القوية) : كانت قوة واحدة !!.. وأنه لم يُسجل أو يُعرف أي شيء عن المادة أو الطاقة أو الزمان أو المكان قبل هذا الزمن " !!!!.. وعندي نقولات كثيرة في ذلك أستاذ هشام تناقض ما قررته أنت من أزلية المادة !!.. فالعالم فريتز مثلا Henry Fritz Schaefer - وهو بروفيسور الكيمياء الحاصل على جائزة نوبل والذي يصنفه البعض كثالث كيميائي عالمي في العصر الحديث - ينقل لنا تأكيد العالم الروسي المولد جورج جامو George Gamow : على أنه مع ذلك الانفجار الكبير : فقد وُلدت كل المادة الموجودة في الكون اليوم : ومعها كل الطاقة بالطبع والأربعة أبعاد للفراغ والزمن من حالة أولية واحدة كانت لا متناهية في الكثافة والحرارة والضغط ...! والنص بالإنجليزية : In 1946, George Gamow, a Russian-born scientist, proposed that the primeval fireball, the "big bang," was an intense concentration of pure energy. It was the source of all the matter that now exists in the universe. The theory predicts that all the galaxies in the universe should be rushing away from each other at high speeds as a result of that initial big bang. A dictionary definition of the hot big bang theory is "the entire physical universe, all the matter and energy and even the four dimensions of time and space, burst forth from a state of infinite or near infinite density, temperature, and pressure والمصدر هي مقالته في الرد على إلحاد ستيفن هاوكينج العالم الفيزيائي Stephen Hawking, The Big Bang, and God .. بل ويؤكد العالم فريتز في نفس المقالة أنه من النادر جداً أن تجد عالماً في الفيزياء ملحداً (أي بسبب اصطدامه بكل هذه الأدلة على وجود خالق حكيم قدير) ..!! ثم يذكر قائلا ً: " لقد تقبل آينشتاين في نهاية المطاف على مضض : بضرورة وجود نقطة بداية للكون .. ومن ثم : وجود قوة مهيمنة متسببة في الأحداث !.. ولكنه لم يقبل مطلقاً بحقيقة وجود إله مشخّص" !!.. أي رفض تعيين ذلك الإله (إله إسلامي هندوسي بوذي نصراني إلخ) ... والنص بالإنجليزية : Einstein ultimately gave grudging acceptance to what he called "the necessity for a beginning" and eventually to "the presence of a superior reasoning power." But he never did accept the reality of a personal God...
    ---------------

    6...
    أقول : هذا الاعتراف من أنشتين بإله (غير مشخص) يترجم لنا (العجز) الإلحادي أمام مسألتين لا يدركهما إلا علماء الفيزياء وهما : 1- عدم أزلية الكون أو المادة 2- التوافق الرهيب بين قوانين وثوابت الكون بدرجة لا يمكن صدورها عن مادة صماء (بلا وعي) !!.. حيث انتهى الأمر أخيرا حتى بستيفن هوكينج نفسه للاعتراف بالقوانين الخالقة : بدلا من (الإله) الخالق !!!.. مجرد تكبر آخر ونقل المسألة إلى إلحاد فلسفي لا معنى له !!.. وهذا يقودنا للنقطة الأخيرة التالية التي أختم بها هذه المشاركة وهي : الدقة المتناهية في الكون وقوانينه .. ولكني قبل الانتقال لها أود الإشارة فقط إلى معضلة أخرى أمام فرضية أزلية المادة الإلحادية وهي معضلة : الأنتروبي !!!.. حيث معلوم أن أي نظام يتجه لزيادة أنتروبيته مع الوقت إلى أن يصل إلى حال الاتزان .. وفي مقابل ذلك : تحويل هذا النظام إلى أنتروبي قليله كما نراه الآن في الكون وأفلاكه وانتظام علاقاته الحركية : يتطلب شغلا .. والسؤال : من هو صاحب هذا الشغل الذي جعل المادة هكذا ؟؟.. والسؤال الثاني : لو أن المادة أزلية : فلماذا لم تكفيها مدة (الأزل) للوصول لحالة الاتزان والانتروبي العالية المطلقة والاستقرار حسب القانون الثاني للديناميكا الحرارية ؟؟.. أيضا : محاولة وصف الفراغ الكوانتي بأنه (العدم) : وربط ذلك بظهور الجزيئات منه (أي من العدم حسب التلاعب بالألفاظ) : فهو أيضا مردود عليه .. لأن الفراغ الكوانتي في عالم فيزياء الكم : لا يعني (العدم) الذي هو (لا شيء) !!!.. يقول العالم Robert C. Koons :

    In quantum mechanics, the vacuum is not a nothing. It is the indeterministic cause of the temporary existence of the virtual particlesوالمعنى التقريبي : " في ميكانيكا الكم : الفراغ لا يعني اللاشيء (يقصد الفراغ الكوانتي الذي تظهر فيه الجزيئات فجأة وتختفي) ولكنه حالة الوجود المؤقت للجزيئات (أقول : مثلما يحدث عند تصادم ألكترونين : وظهور فوتون افتراضي لحظي لنقل التآثر الكهرومغناطيسي بينهما) ..! وهو نفس ما يقوله Quentin Smith من أن فراغ الكم : هو حالة الضرورة الفيزيائية لظهور الجسيمات الافتراضية .. ويدلنا وصف الضرورة الفيزيائية إلى السببية في هذا الظهور .. أي أنه يصح أن نقول أن ظهور هذه الجسيمات الافتراضية كان لسبب .. ومن احتمالات تعريف السببية : يمكننا القول بأنه للجسيمات الافتراضية سبب .. وأنه لأي فراغ كوانتي احتمالية أكيدة لتولد الجسيمات الافتراضية به .. والنص بالإنجليزية : A quantum vacuum is a physically necessary condition of a virtual particle coming into existence and, in this 'physically necessary' sense of causation, virtual particles may be said to have causes. A probabilistic definition of causality would also enable us to say that virtual particles have causes, for given a quantum vacuum there is a certain probability that virtual particles will be emitted by it .......###....... سادسا وأخيرا : وهو انتفاء أن تكون المادة أزلية ونشأ عنها الكون الغاية في الدقة والإحكام : لأن المادة (غير واعية) !!!.. وهو ما يطلق عليه العلماء اسم : التوافق الدقيق للكون Fine-tuned Universe .. يقول عالم الفيزياء الإنجليزي الشهير بول دافيز : " يمكن القول أن هناك اتفاق واسع بين علماء الفيزياء والكونيات الآن على أن الكون : خاضع لتدقيق متناهي من أجل وجود الحياة " !!!.. المرجع - Paul Davies (2003) How bio-friendly is the universe?, International Journal of Astrobiology, vol. 2, no. 2: 115 ويقول أيضا ً: " يصعب مقاومة انطباع أن التكوين الحالي للكون الذي يبدو حساساً للتغيرات الصغيرة في المعايير : قد تم التفكير فيه بعناية ..!! فلا بد أن يظل التوافق المعجز الواضح في القيم العددية - التي حددتها الطبيعة لثوابتها الأساسية لها : أكثر الأدلة الدامغة على عنصر التصميم الكوني " !!.. المرجع - Paul Davies.God and the New Physics.New York, Simon & Schuster, 1983, p.198 .....
    ---------------

    7...
    كمثال على هذا التدقيق المتناهي في ثوابت الكون والفيزياء لظهور العالم الذي نحياه : فقد أثبت عالم الفيزياء النظرية الأسترالي براندون كارتر في بداية الثمانينات من القرن العشرين : أن ثابت نيوتن للجاذبية (G = 6.67384×10-11 m3/kg.s2) : لو تغير بمقدار بالغ الضآلة لا يتعدي واحد علي عشرة ديوديسيليون (وهو 1 علي يمينه أربعين صفراً) : لما كانت الشمس موجودة !!.. ولما أصبحت الحياة علي كوكب الأرض ممكنة !!!.. المرجع - Davies, Paul (1984) Superforce: The Search for a Grand Unified Theory of Nature. New York: Simon and Schuster وبنفس هذه الصورة المذهلة التي أبهرت العلماء (المؤمنين والملاحدة على حد سواء) : يتكرر هذا التدقيق المتناهي في عشرات القيم العددية في الكون !!.. مثل سرعة الضوء ..! ومقدار الشحنة الكهربية للإلكترون ..! والعديد من الثوابت الرياضية مثل : ثابت بلانك ..! وثابت بور وغيرها ..! ولذلك نجد عالم الفيزياء النظرية الشهير ستيفن هوكينج الملحد نفسه يقول في كتابه "تاريخ موجز للزمان" : " إن القوانين الرياضية العلمية كما نعلمها في الوقت الحالي تحتوي علي العديد من الأرقام الأساسية مثل : مقدار الشحنة الكهربية للإلكترون .. والنسبة بين كتلتي الإلكترون والبروتون ...إلخ والحقيقة الجديرة بالتأمل : أن قيم هذه الأرقام : يبدو أنها قد تم تدقيقها بشكل متناهي : حتي يمكن للحياة أن تنشأ وتتطور " !!!!.. المرجع - Stephen Hawking, (1988) A Brief History of Time, Bantam Books .. ويقول أيضا ًفي نفس الكتاب : " إذا كان معدل التمدد بعد ثانية واحدة من الانفجار الكبير : أصغر بمقدار حتى جزء واحد من مائة ألف مليون بليون : فالكون سينهار ثانية ًعلى نفسه : وقبل أن يصل إلى حجمه الحالي " !!.. المرجع - Stephen Hawking ,A brief History of time , Bantame press ,london :1988.p.121-125 ... ويشرح لنا جانبا ًمن هذا التعقيد : عالم الأحياء البيولوجية الشهير مايكل دانتون في كتابه (قدر الطبيعة) فيقول : " مثلاً : إذا كانت قوة الجاذبية الثقالية : أقوى بتريليون مرة : فالكون سيكون غاية في الصغر : وتاريخ حياته قصير جداً !!.. فمن أجل نجم متوسط كتلته أقل بتريليون مرة منها للشمس : فسوف لن تمتد حياته لحوالي سنة !!.. ومن ناحية أخرى : إذا كانت الجاذبية الثقالية : أقل طاقة : فلن تتشكل نجوم ولا مجرات إطلاقاً !!.. وكذلك : فإن العلاقات الأخرى والقيم : ليست أقل حدية من ذلك !!.. فإذا ضعفت القوة القوية بمقدار قليل جداً : فسيكون العنصر الوحيد المستقر هو غاز الهيدروجين !!.. ولن توجد ذرات لعناصر أخرى في هذه الحالة !!.. وإذا كانت أقوى بقليل بعلاقتها مع الكهراطيسية : عندئذ : تحتوي نواة الذرة على بروتونين !!.. وسيكون ذلك مظهراً لاستقرار الكون عندئذ !!.. وأنه لن يحتوي على غاز الهيدروجين !!.. وإذا تطورت نجوم أو مجرات فيه : فسوف تكون مختلفة تماماً عن طبيعتها الحالية !!.. واضح أنه إذا لم يكن لتلك القوى المختلفة وثوابتها : القيم التي أخذتها بالضبط : فسوف لن يكون هناك نجوم ولا مستعرات ولا كواكب ولا ذرات ولا حياة " !!!.. المرجع - Michael Denton .nature,s Destiny :Hom the laws of Biology Purpose in the universe The new york:The free press .1998.p.12-13 والنقولات والتفاصيل الرياضية في ذلك عندي كثيرة أستاذ هشام .. ومنها تفاصيل رقم اثابت الكوني الذي توصل إليه روجر بنروز Roger Penrose (عالم فيزيائي وصديق لستيفن هاوكينج) والذي قيمته الاحتمالية = (10 أس 10 123) إلى واحد !!!!!.. لظهور الكون والحياة !!!!!.. وهو ما يساوي المستحيل نفسه !!.. وهو الذي لو أردنا تمثيله واقعيا : لاحتاج زمنا يفوق زمن الكون أصلا بمليارات مليارات مليارات مليارات إلخ المرات : ليظهر ويتوافق صدفة من دون فاعل مريد حكيم قادر !!!.. ولذلك يقول بنروز بكل وضوح : " يخبرنا هذا العدد عن : مدى دقة هدف الخالق !!.. والتي : يجب أن يكون عليها هذا الهدف : الكون " !!.. المرجع - Roger Penrose.The amperors new Mind.1989.michael Denton natures desting .Thenew york :the free press 1988.p.9. وعلى هذا أستاذ هشام : فحتى أعتى الملاحدة لم يستطع تفسير هذا التوافق الدقيق للكون بقوانينه وثوابته .. وإذا سمحت لي يمكنني أن أضع لك رابط أحد الفيديوهات الرائعة التي توضح ذلك (مدته 13 دقيقة) حيث يعرض فيه لقاء بين ريتشارد داوكينز وأحد علماء الفيزياء الملاحدة وهو يعترف له - أي هذا العالم الفيزيائي الملحد - أن تلك الحقائق أحرجت الإلحاد أيما إحراج - أي في عدم وجود خالق مدبر حكيم ومريد للكون - !!!.. وأتوقف هنا وأعتذر عن الإطالة التي اضطرني لها بعض عبارات الأستاذ هشام : فلجأت للكثير من التوثيق لنفي ما قد يكون قد فهمه منها بالخطأ .. مع ملاحظة أني لم أتطرق لباقي الإعجاز في المخلوقات الحية نفسها وفي الخلية والحمض النووي إلخ إلخ لأن اهتمامي كان بالرد على خلق الكون بأكمله تحديدا .. والآن أترك لك أستاذ هشام التعليق مشكورا .. وبعد تحيتك على أسلوبك المهذب في الحوار إلى الآن وفقك الله .. انتهيت

    التعديل الأخير تم 03-11-2013 الساعة 05:46 PM

  2. #2
    تاريخ التسجيل
    Apr 2012
    الدولة
    دار الممر
    المشاركات
    1,717
    المذهب أو العقيدة
    مسلم
    مقالات المدونة
    6

    افتراضي

    بارك الله فى جهودكم أخانا الكريم
    ولا أعلم هل عندكم قسم فى المدونة لهذا أم لا
    لكن أقترح عليكم عمل قسم اسمه مناظرات
    سيكون طيب جدا ويوفر كثير من طرح أسئلة تُعاد وتُكرر
    وفقكم الله
    ليس فى تلك الحياة كلها شيء اغلى من الدين
    فهو من أجله خُلقت ومن أجله تموت ومن أجله تُبعث


    فإ ن المتتبع للفتن العظيمة التي ألمت
    بأمة الإسلام على مدار تاريَخها؛ لا يكاد
    يجد فتنة منها إلا وقد قيض الله لها )إمام
    هدًى( يلي الأمر بالمعروف والنهي عن
    المنكر حقًا، ويسلك سبيل أئمة الهدى
    قبله في الأخذ بيد )العامة والخاصة( على
    طريق النجاة من الفتنة، لا بشيء سوى
    بالدلالة على )الوحي( و)معنى الوحي(
    و)مقتضى الوحي(


    http://www.ahlalhdeeth.com/vb/forumd...aysprune=&f=27

  3. #3

    افتراضي

    اقتباس المشاركة الأصلية كتبت بواسطة قلب معلق بالله مشاهدة المشاركة
    بارك الله فى جهودكم أخانا الكريم
    ولا أعلم هل عندكم قسم فى المدونة لهذا أم لا
    لكن أقترح عليكم عمل قسم اسمه مناظرات
    سيكون طيب جدا ويوفر كثير من طرح أسئلة تُعاد وتُكرر
    وفقكم الله
    http://abohobelah.blogspot.com/2012/10/blog-post_8.html

    وأحاول ضم بعض الحوارات الهامة إليه ...
    بارك الله فيكم ...

  4. #4
    تاريخ التسجيل
    Oct 2012
    الدولة
    مصر
    المشاركات
    1,314
    المذهب أو العقيدة
    مسلم
    مقالات المدونة
    5

    افتراضي

    رأيته مفلس هرب كالفرخه

  5. #5

    افتراضي

    مناظرة مع الملحد هشام آدم بعنوان : وجود الله ..
    الجزء 2 ...
    جرت هذه المناظرة في جروب (نقاش فكري) على الفيسبوك ..
    وقد انتهت بانسحاب الملحد بأعذار أني أخطأت ولفقت ودلست فيها .. ولله الحمد ..!
    ---------------

    8...
    أهلا بك أستاذ هشام من جديد .. وسوف أقوم بتقسيم مداخلاتي لاثنتين أو ثلاثة ردا على مداخلاتك الخمسة إلى الآن .. والتقسيم هذه المرة موضوعي وليس لكبر الحجم .. أقول .. أما بالنسبة لمداخلتك الأولى : فلا أجد داعيا لأن أعلق على ما جاء فيها .. إما لأنه صواب فلا يحتاج إلى تعليق .. وإما لأنه سابق للترتيب المنطقي للحوار وأنت بنفسك نوهت إلى ذلك ((مثل إظهارك لاعتراضك الأساسي على أن يكون الخالق هو إله بالمفهوم الإسلامي : حيث أنك لا تجد غضاضة في الاعتراف بخالق حكيم إذا اقتنعت بذلك)) وإما لأنه يعد من التشتيت الذي ليس محله مناقشته الآن : وأيضا أنت تعرف ذلك وذكرته مشكورا .. وإنما أعلق فقط على قولك : "" وهكذا فإننا نرى أنَّ المفهوم الإسلامي لا يفرق فعليًا بين الخالق (الرب) والإله ... ففي المفهوم الإسلامي فإن الله هو الخالق، وهذا الخالق هو المستحق للعبادة وهو متطلب لها لأنه متفضل على البشر "" أقول : هذا الكلام يُفهم عندنا بصورة واحدة صحيحة وهي : أنه في الإسلام يكون : الرب الخالق : هو الإله الواحد الحق المستحق للعبادة .. وليس كالنصارى مثلا ًيكون الخالق هو الله : ثم المعبود المألوه المُشرع هو المسيح مثلا أو غيره !!!.. فهذه هي الصورة الوحيدة الصحيحة التي نفهم بها قولك .. وإلا : فإذا كنت تعني : نفي ما أثبته أنت سابقا من تفريق الإسلام بين ((مفهوم)) الرب والإله : فهذا من الخطأ بمكان .. فهما مفهومان متباينان ولكل منهما خصائصه ومدلولاته .. وبالعموم : هم ثلاث صفات رئيسية لله عز وجل : يندرج تحتهما غيرهما .. وقد ذكر الثلاثة الله تعالى في قوله في أول سورة الناس : " قل أعوذ برب الناس .. ملك الناس .. إله الناس " .. هذا تعليقي على مشاركتك الأولى ..
    ---------------

    9...
    للأسف الشديد : مسألة محدودية عدد الأحرف في المداخلة الواحدة مقيدة جدا للرد بعكس ما تعودت في منتدى التوحيد .. وأعتذر عن تقسيم هذه المداخلة الثانية إلى جزءين .. حيث قلت :
    والآن أستاذ هشام : نأتي للجزء الأكثر تعمقا منذ مداخلتك الثانية .. وصراحة ً: أنت كنت في غنى عن ذكر القوانين الرياضية والمعادلات والصيغ إلخ إلخ إلخ .. واستبدالها بالكلام المجمل العام الدال على المعنى الذي تريد : ومثلما أفعل أنا سواء في كلامي أو ما أختاره وأقتبسه من النصوص العلمية .. حيث أحاول الابتعاد عن التفاصيل الرياضية والعلمية والقوانين التي لن يفهمها الكثيرون .. هذه فقط ملاحظة سريعة .. والآن نأتي لأول جزء من مداخلتك الثانية الذي قلت أنت فيه : "" بالنسبة إلى موضوع (أزلية الخالق) والمثال الذي أفردته، فالحقيقة أنني لم أقف على وجه الوجاهة في الاستشهاد به، فدائمًا عندما تبني استنتاجك على فرضية خاطئة فإن الاستنتاج بالضرورة يكون خاطئًا؛ فالأمور والظواهر الكونية لا تتشابه بأي حال من الأحوال مع مثال الجندي الذي ينتظر أمرًا من قائده لأن الظواهر الطبيعية يمكن إحداثها دون توقع حدوثها بمعجزة، لماذا: لأن الظاهرة تحدث بسبب قوانين طبيعية، والقوانين الطبيعية ليس سوى "خصائص" المادة التي تفسّر سلوكها "" أقول : مثال الجندي مع القائد : ينفي فكرة تسلسل الأسباب أو (الخالقين) أو (المُحدثين) إلى ما لا نهاية .. والآن .. أنت خرجت من حيزها إلى حيز آخر وهو : أنك تثبت بالفعل مرجعا ًأزليا ً- وهو الغرض من مثال الجندي الذي (يجب) أن ينتهى بأول أزلي - ولكن الاختلاف بيني وبينك هنا : أني أراى ذلك الأزلي هو الله عز وجل : الحكيم العليم المدبر القدير المريد .. في حين أنك تراه المادة : بقوانينها الأزلية الطبيعية الملتصقة بها .. حسنا ًأستاذ هشام .. هنا ينتقل الحوار إلى هذه النقطة تحديدا ًوهي : هل فعلا المادة أزلية : وقوانينها كذلك ؟؟.. وقبل التطرق لتفاصيلك (العلمية) (الرياضية) لمحاولة برهنة ذلك .. أشير هنا إلى قضية أنت أثرتها من وسط مداخلتك الثانية وإلى آخرها .. وهي قضية علاقة الله تعالى بالقوانين التي وضعها لسير الكون والأشياء .. حيث حاولت تفنيد فكرة وجود الإله أصلا ً: من ناحيتين .. ناحية علمية .. وناحية فلسفية جدلية .. فأما الفلسفية الجدلية (مثل إشارتك لترك الله لحدوث الزلازل وموت الأطفال إلخ إلخ) : فهذا مما هو سابق لأوان الرد عليه كما قلت سابقا ً.. لأنه يأتي بعد قضية إثبات وجود خالق من عدمه أولا ً!!!.. وأما الناحية العلمية : فهذه هي التي قلت أنت فيها : "" وهذا نص قانون الصدفة الذي يسخر منه غالبية المؤمنون، وليس ذلك إلا لأنهم يخلطون بين "الصدفة" وبين "العشوائية" فالصدفة باختصار شديد: "توفرّ مجموعة من العوامل بشكل غير واعي ينتج عنه ظاهر طبيعية" وعندما نبدأ في مراجعة الظواهر الطبيعية ونتمكن من إيجاد تفسيرات لها بعيدًا عن فرضية الخالق فإننا سوف نكتشف أنَّ الخالق هنا أصبح فرضية زائدة، فسواء كان هنالك خالق أم لم يكن فإن المطر سوف يهطل فقط إذا توفرت العوامل الضرورية لذلك، وكذلك الزلازل والبراكين والأعاصير وحتى حركة دوران الأرض حول محورها، بل وحتى حركة الكون والمجرّات فهي إذن مجموعة من القوانين التي لا تحتاج إلى تفسيرات أو فرضيات خارجية، وهذه كانت واحدة من أهم النتائج لنظرية أينشتاين ""

    ---------------

    10...
    أقول : هناك عدة أخطاء هنا .. منها : أن أنشتين نفسه قد اختار أن تكون هناك متغيرات خفية Hidden Variables : لحل معضلات فيزياء الكم التي تهدد بالحكم عليها بالخطأ !!!.. مما يعني اعتراف العلماء الدائم - وحتى اللحظة - بنقص المعرفة الإنساني وأنه سيظل هناك دوما ما يطاردونه لسبر أغوار الخلق : ولن يصلوا أبدا ًلنهايته !!!.. وأما الخطأ الثاني : فهو في تصور أن مقدمات الأشياء تتسبب (قطعا) في وقوعها !!.. وهذه الحتمية لا يمكن إثباتها : طالما لم تتمكن من المقدمات لكل شيء أولا ً!!!.. وذلك يعود بنا إلى النقطة الأولى وهي أنه يكون دوما هناك متغيرات (خفية) يطاردها العلماء لفهم الخلق !!!.. ولعل أقل ما يمكن قوله في ذلك هو جهل العلماء بـ (ماهية) ما يتعاملون معه : رغم رصدهم له !!!!.. فهم لا يعلمون (ماهية) الألكترون !!.. ولا (ماهية) الجاذبية !!!.. إلخ ولذلك لا تتعجب أن يهرب بعضهم من هذه المعضلات جميعا ومن أن ينسب الخطأ لفيزياء الكم - مثلما نسبه إليها روجر بنروز - : إلى (افتراض) أبعاد إضافية لا ندركها : كتلك المذكورة في نظرية الأوتار الفائقة وما شابهها !!.. أو محاولة استبدل البعض الآخر للمتغيرات (الخفية) في كوننا : بـأكوان متوازية (خفية أيضا !!) : تتناسخ كل لحظة بعدد المصائر المحتملة !!!.. وهي كلها (تهربات) نظرية : لا يمكن التحقق منها عمليا ًأصلا ً- ثم يعيبون على المؤمنين الإيمان بالغيب ! - ألجأهم إليها (النقص) الدائم في منظومة فهم فيزياء الكون والخلق وقوانينه : تلك التي تتحدث عنها أستاذ هشام بكل سهولة : وكأنها شيء تحصيل حاصل : لم يعد في حاجة لـ (إله) لنفسرها به !!!.. وهنا أقول : سبحان الله العظيم !!.. لو أخذنا مثالا واحدا فقط وهو الجاذبية الأرضية : تلك القوى العجيبة التي حيرت العلماء - ومن أجلها يجري العمل على قدم وساق في مختبر سيرنCERN الذي ذكرته أستاذ هشام - ليخرجوا لنا بتفسيرات مثل (اختفاء) الجزيئات الحاملة للجاذبية إلى بعد آخر (أي أنها غير مستقرة في عالمنا) : ليفسروا بذلك معضلة أن الإنسان يمكنه بكل بساطة تحدي جاذبية الأرض الكبيرة التي تجذب القمر مثلا ً: بالقفز عاليا أو بحمل تفاحة بعيدا عن الأرض أو انتشال قطعة حديد من على الأرض بمغناطيس صغير !!.. إذا ً- وكما قلت لك أستاذ هشام - هناك دوما مهيمنا أعلى على قوانين الفيزياء والخلق ومقدراته وقوانينه : وهو الذي يقتتات كل شيء عليه في بقائه !!!.. يقول عز وجل في القرآن الكريم سورة فاطر : " إن الله يمسك السماوات والأرض أن تزولا ولئن زالتا إن أمسكهما من أحد من بعده إنه كان حليما غفورا " !!.. ولو صح كلامك أن الإنسان قد فسر وعرف كل شيء وملكه - المطر كمثال - : لكان الإنسان اليوم هو مالك الكون وما فيه !!!.. ولأنزل المطر في أي مكان وزمان شاء !!!.. ولكنك ترى دوما نقصان أحد متغيرات العملية الفيزيائية - أو أكثر - : واستئثار الله عز وجل بها في علمه ومشيئته !!.. ولعلك سمعت أو قرأت عن فشل الأمطار الصناعية تارة في استحداثها لعدم ملائمة الجو في وقتها .. وتارة أخرى في توجيه سقوط المطر في المكان المطلوب !!.. لن أطيل أكثر من ذلك في هذه النقطة .. ولكن أختم مداخلتي الثانية هذه بالتعليق على قولك : "" ومن ناحية أخرى وثيقة الصلة؛ فإن الخالق (حسب التصور الإسلامي) لا يحتاج إلى التدخل المباشر لإحداث ظاهرة لأنه {وإذا قضى أمرًا فإنما يقول له كن فيكون} وتسلسل العوامل لأيّ ظاهرة طبيعية ينفي هذه الميزة التي ينسبها الإسلام إلى الخالق المتصوّر في ذهنيته، حتى عندما وُجد الكون تطلب مليارات السنوات ومليارات الحوادث حتى ينشأ العالم الحيّ الذي نعرفه الآن "" .. أقول : أنت هنا خلطت بين مفهومين .. وبين سنتين لله تعالى في خلقه (وحسب التصور الإسلامي الصحيح وليس المغلوط) .. ألا وهما : أنه يقضي أمورا ًتارة ًبأسبابها وسننها التي أودعها في مخلوقاته وكونه (مثل خلقه للسماوات والأرض في ستة أيام .. وخلقه لآدم عليه السلام على أطوار) .. وذلك لحكم كثيرة منها : أنه يفتح الآفاق والمجالات للإنسان ليتفكر بعقله الذي وهبه له في عظمة الخالق ودلائل خلقه الدقيق المعجز .. وكمثال على ذلك يقول تعالى في سورة العنكبوت : " قل سيروا في الأرض فانظروا كيف بدأ الخلق ثم الله ينشئ النشأة الآخرة إن الله على كل شيء قدير " .. رغم أنه يعلم سبحانه أن الإنسان ومهما بلغ علمه : لن يصل إلى صورة نهائية عن كيفية خلق السماوات والأرض ولا نفسه : ولكن آثارهما فقط .. يقول عز وجل في سورة الكهف : " ما أشهدتهم خلق السماوات والأرض : ولا خلق أنفسهم : وما كنت متخذ المضلين عضدا " !!!.. فهذه الأمور التي يقضيها سبحانه : يقضيها بسننها وقوانينها التي أودعها في مخلوقاته وكونه وعليها تجري .. وأما تارة ًأخرى يقضي بكن فيكون .. ولا حاجة له سبحانه للخضوع للسنن والقوانين التي وضعها بنفسه في كونه (وحاشاه) !!.. وهذا هو أحد علامات الإعجاز في الخلق : ومعجزات الأنبياء والمرسلين إلخ .. فالبحر ينشق طريقا يبسا لموسى عليه السلام !!.. والنار تكون بردا ًوسلاما ًعلى إبراهيم عليه السلام !!.. وعيسى يقوم بتشكيل الطين على هيئة الطير فينفخ فيها فتكون طيرا من فورها بإذن الله - ولا حاجة لأطوار خلق ولا غيره - !!!.. وهكذا .. وهذه هي نهاية مداخلتي الثانية : ردا على المداخلة الثانية للأستاذ هشام .. وتليها المداخلة الثالثة والأخيرة بإذن الله تعالى ردا ًعلى مداخلاته الثلاث لمحاولة إثبات أزلية المادة ..
    ---------------

    11...
    < لطول المشاركة قليلا عن الحد المسموح به : قسمتها لمداخلتين > .. بسم الله الرحمن الرحيم .. وقبل أن أبدأ : أعترف أولا بالفضل من بعد الله عز وجل إلى إخوة أكارم من منتدى التوحيد : أخذنا منهم الكثير من العلم الفيزيائي والمفاهيم وإظهار المتناقضات في افتراضات الملاحدة الفيزيائية .. وأخص بالذكر هنا الأخ الفاضل عبد الواحد .. والأخ أبا ذر الغفاري .. والأخ عبد الله الشهري .. والآن : أعود للتعليق على مداخلة الأستاذ هشام الثالثة - وسوف أتجنب الكلام الرياضي البحت في حديثي بعكس ما فعل هو مراعاة لمستوى معظم القراء المعرفي بالفيزياء والرياضيات - أقول : يشير الأستاذ هشام إلى نقطة هامة جدا -أو محورية - في العقل الإلحادي القائل بأزلية المادة وهي نقطة : ثبات القوانين الفيزيائية الحاكمة لهذه المادة .. يقول : "" ولكنني أتحدث عن "قانون" ولا أعرف كيف يُمكن أن يتم تجاوز القانون أو إلغاؤه، فهل فعلًا القوانين متغيّرة؟ هل يُمكن مثلًا أن نقول إنَّ قانون الطفو لأرخميدس قد يثبت خطأه بعد ألف عام مثلًا؟ القوانين يا عزيزي الفاضل لا تتغيّر وهي ثابتة "" أقول : هذا الكلام غير صحيح من جهتين .. أولا ً: أن القوانين التي تتحدث عنها أستاذ هشام : لم تظهر أصلا ًإلا بعد الانفجار الكبير !!!!.. ولو كانت قبله : فأين هي آثارها من قبل الانفجار الكبير ؟؟!!.. ما الذي ضغط القوى الأربعة الأساسية مثلا ً(الجاذبية والكهرومغناطيسية والنووية الضعيفة والنووية القوية) : في قوة واحدة مجهولة الحال : ثم قام بتفتيتها إلى الأربعة قوى من جديد ؟!!.. غريب صح ؟!!.. وأما الجهة الثانية التي تدحض أزلية القوانين التي تتحدث عنها : فهي مكملة للجهة الأولى : ومفادها : أن القوانين التي تصفها بعدم التغير والأزلية : تعتمد أصلا ًعلى قيم وثوابت : ولدت مع الانفجار الكبير أيضا !!!!.. مثلا ً: طاقة التجاذب بين كتلتين :U= -GMm/r : فهذا القانون لا يمكن تحققه إلا ((((بعد)))) الانفجار الكبير وإلا : فثابت الجاذبية G : لم يكن موجودا قبل زمن بلانك !!!.. وكذلك المسافة r ليس لها معنى قبل تشكل المكان والأبعاد !!!!.. فعن أي (ثبات) قوانين وأي (أزلية) تتحدث أستاذ هشام ؟!!!... والعجيب أن كل ما ذكرته في مداخلتيك اللتين بعد ذلك (الرابعة والخامسة) : يمكن هدمه كله بنفس هذه المعضلة !!!.. فكله قوانين - وإذا لم تنتبه- : تعتمد على ثوابت لم تولد أصلا ًإلا بعد الانفجار الكبير ولم يكن لها وجودا قبل زمن بلانك !!.. وخصوصا وأنك خلصت منها إلى استنتاجات عجيبة مثل قولك أن الكون كله عبارة عن ثقب أسود كبير !!!.. فمثلا قانون كثافة الثقب الأسود P= 3C EXP 2 / 8 * PI * G* R EXP 2 .. وقانون نصف قطر الثقب الأسود = R<=2GM/C2 .. أيضا قانون الكثافة الحرجة = Pc=3H EXP 2/ 8 PI * G إلخ إلخ .. وكلها قوانين تمتليء بثوابت : لم يكن لها معنى أصلا ًولا قيم قبل زمن بلانك !!!!.. -ملحوظة على الهامش : لو أن الكون كله عبارة عن ثقب أسود كما تقول أستاذ هشام : فيجب أن تكون له نقطة محددة ومعروفة يكون فيها انبثاق المادة والضوء مستمر !!.. لأن هذا ما يحدث في الجهة الأخرى من الثقب الأسود من الخارج ألا وهو ابتلاع المادة والضوء إلخ من حوله إلى جوفه ! فكان يتحتم أن نرى معكوسه في كوننا طالما أنك وصفتنا أننا الثقب الأبيض !! مجرد ملحوظة بديهية - والآن : أعود إلى تعليقك أستاذ هشام على ترجمتي
    ---------------

    12...
    حيث قلت أنت : "" والترجمة الأقرب هي: قبل زمن ما يعرف بزمن بلانك ("سالب43" مرفوع للقوة 10 ثانية) يفترض أن القوى الأساسية كانت موحدة في قوة واحدة. كل المادة والطاقة والزمان والمكان يُفترض أنها انفجرت من هذه القوة الأصلية، ولا يُعرف شيء عن هذه الفترة "فترة الانفجار أو ما قبلها "" أقول : ما أجملته أنت : قد فصلته أنا في ترجمتي التقريبية كما وصفتها : لأني أتعمد دوما الشرح بداخل الترجمة (ولذلك تجدني ذكرت أسماء القوى الأربعة للقاريء ولم أتركها مبهمة لمَن لا يعرفها) وعلى أي حال : فحتى ترجمتك الدقيقة : هي تثبت المعضلة التي أخبرتك بها !!!!.. لأنها تعترف باختزال القوى الأربعة التي تقوم عليها الفيزياء والكم : بقوة واحدة مجهولة : لم يكن لكل الثوابت التي تستخدمها (القوانين) أي معنى ولا وجود !!!.. فكيف بعد ذلك تصف القوانين بالأزلية أو الثابتة أستاذ هشام : وهي وليدة كوننا هذا كما أخبرتك من قبل ؟!!!.. والشاهد حتى لا أطيل : لو أردت نقاشا علميا ورياضيا أكثر تفصيلا في نقطة أزلية المادة وقوانينها : يمكننا تخصيص المداخلات القادمة لذلك .. هذا من الوجهة العلمية .. وأما من الوجهة المنطقية البديهية : فالكل يعرف أن القانون : يحتاج إلى مَن يقننه !!!!.. وليس أن نصفه بالأزلية !!!.. فأنا لو وجدت غسالة لها وظائف معينة ومحددة بقوانين لا تتغير : فلا أقول أن تلك القوانين والوظائف أزلية !!.. ولكني أقول أن هناك حكيم مريد عالم : هو الذي وضعها !!.. وحتى لا أطيل : فإن معلوماتك عن تجربة يوري وميلر وكريج فنتر كلها مغلوطة للأسف أستاذ هشام وقديمة !!!.. فأما تجربة ميلر 1953م : فالكل عرف بعدها أنه قد افترض جوا ًللأرض : لا يوافق ما هو معروف !.. وخصوصا بالنسبة لوجود الأكسجين وعلاقته بالأوزون والأشعة الفوق بنفسجية !!.. حتى ميلر نفسه اعترف بضعف تجربته الهش أمام مجرد تخيل تكوين البوليمرات المعقدة !!.. ولعلك - لو أردت - نفرد لتفنيد هذه التجربة مداخلة كاملة نشرح فيها تعقيد تكون البروتينات والبوليمرات .. وأما كريج فنتر ورغم أن الضجة التي أحدثها جديدة : إلا أن المعلومات التي اعتمد عليها : هي معروفة وقديمة في عالم البيولوجيا الجزيئية !!!.. وذلك من سحب حمض نووي من خلية وزرعه في أخرى إلخ .. والجديد هو في محاكاتهم لحمض نووي بكتيري : ليس لهم أي يد في اختراعه ولا تشفيره أصلا ً- فكيف تصفه أنت أستاذ هشام بالصدفة ؟!! - : ثم زرعه في خلية أيضا ًليس لهم خلقها !!!!.. إذا ً: الموضوع كله فرقعة إعلامية وتلاعب بالألفاظ : ولا ننكر أنه خطوة علمية ولكن : لا علاقة لها بالخلق البتة !!!!.. وأيضا إذا أردت إفراد هذه النقطة بالنقاش : فلا مانع عندي .. انتهيت
    ---------------

    13...
    أهلا بك أستاذ هشام من جديد .. وهذه المرة بإذن الله تعالى : أمامي الرد على أكثر من مسألة قد طرحتها أنت في مداخلاتك .. ولكني - وكالمعتاد - سأستبعد تعرضك (الآن) لشبهات بخصوص (الإله) : لأعود بسير الحوار المنظم إلى نقطة وجود (خالق) حكيم عليم أزلي من عدمها أو محاولتك استبداله بـ (المادة) الأزلية و(خصائصها) ومحاولتك إظهار (تساوي) الرأيين عقلا ومنطقا وعلما .. حسنا .. دعني الآن أقوم بترتيب ردودي في مداخلاتي .. وبالترتيب .....### أولا ### عودة لموضوع أزلية المادة وقوانينها أو (خصائصها) أستاذ هشام : لننتهي منها هذه المرة بإذن الله تعالى بلا رجعة .. فأنت قلت في اقتباس طويل من كلامك : "" الأمر هنا يا عزيزي مرتبط في المقام الأول بما يسمى بخصائص المادة، وخصائص المادة لا تتغيّر ولا توجد فجأة؛ فمثلًا من خصائص المادة السائلة أخذها لشكل الإناء الذي هي فيه، وهذه الخاصية لا يُمكن أن تتغيّر، ولا يمكن القول بأنَّ هذه الخاصية لم تكن مرتبطة بالمادة السائل في أي فترة زمنية سابقة، والمُطالبة بإثبات صحّة هذه الخاصية هو ضرب من الترف العلمي الذي لا معنى له، وكذلك أزلية المادة هي أحد خواص المادة، والخاصية تختلف يا عزيزي عن الوظيفية (Function) فقدرة المغناطيس على جذب الحديد مثلًا هي خاصية وليست وظيفة، وهنا مكمن المفارقة في مثال "الغسالة" الذي سردته. القوانين التي تحكم المادة يا عزيزي هي في الأساس "خصائص" والخصائص مرتبطة تمامًا بالمادة نفسها، وهذا يُمكن اعتباره ردًا على فرضيتك بأنَّ القوانين تحتاج لمن يُقننها؛ فلا يُمكنك التفريق بين المغناطيس وخاصية المغنطة مثلًا لنقول إنّّ المغنطة قانون وجود بعد وجود مادة المغناطيس. هذا ليس صحيحًا، والصحيح أنَّ خصائص المادة لا تنفصل بحال من الأحوال عن المادة ذاتها، وبما أنَّ المادة أزلية (بالنسبة إليّ في هذا الحوار) فخصائصها أيضًا أزلية "" وأقول : عن خصائص أي (((مادة))) تتحدث أستاذ هشام إذا سمحت ؟؟!!!.. بمعنى آخر : دعنا نكون منطقيين وعقلانيين أكثر في طرحنا للأفكار معا - ويعلم الله أني سعيد بحواري معك وصدق مجراه - : ودعنا نترك ما ننقله أو نقرأه جانبا : لننظر له نظر الناقد أنا وأنت .. والآن أكرر سؤالي : عن أي (((مادة))) تتحدث أستاذ هشام وتنسب لها (((خصائص))) أزلية ؟!!!.. عن مادة : لم تظهر بعد للوجود ؟؟!!.. هل لاحظت أستاذ هشام أنك كررت أكثر من مرة أن تلك الحالة الأولى للانفجار الكبير كانت تحت حرارة رهيبة وضغط إلخ .. والآن : هل تفكرت في ذلك الكلام حقا وقبل أن تتحدث عن (خصائص) لهذا (الشيء) إذا صح التعبير ؟!!!.. هل تعلم شيئا أستاذ هشام عن الاندماج النووي - مثلما يحدث في النجوم - وكيف تتولد عنه نواة المواد الخفيفة : ثم المتوسطة : ثم الثقيلة ؟!!!.. أقول : إذا كان هذا هو ما يحدث في النجوم التي بأضعاف المليارات : وبأحجامها المتفاوتة والهائلة : فماذا تعتقد أستاذ هشام أنه كانت عليه هذه النقطة الصغيرة (الشيء) الذي كان قبل الكون الذي نعرفه الآن إذا سمحت ؟!!.. أين هو الحديد -الذي لم يولد بعد - في هذا الشيء ؟؟!!.. أين هي الموائع - والتي أيضا ًلم تولد بعد - في هذا الشيء ؟!!.. هل أنت تدرك معنى هذا الكلام أستاذ هشام ؟!!.. هل تدرك معنى وجود حرارة بقيمة خرافية مع ضغط خرافي إلخ إلخ في نقطة لا متناهية الصغر في الحجم ؟!!!.. هل توجد أي عقلانية في القول بأنه هناك (خصائص) لأشياء : لم تولد ولم تتمايز أصلا ًعن بعضها البعض بعد ؟!!!!.. حسنا ً.. ودعني أنظر للمسألة من وجهة نظر أخرى موازية .. هل تعرف أستاذ هشام ما هي أهم معوقات إجراء مفاعلات الاندماج النووي في عالمنا الآن ؟؟.. إنها الطاقة الكبيرة التي يتطلبها مثل هذا الاندماج .. وإلا : فنحن نريد اندماجا لتنتج عنه حرارة رهيبة : لنستخدمها لتوليد الكهرباء ولكن بشرط : ألا تكون تكلفة هذا الاندماج النووي : أعلى بكثير من مردوده !!!.. وإلا فليس هناك فائدة لأدفع 10 تفاحات لأحصل على 3 تفاحات صح ؟؟..
    ---------------

    14...
    حسنا حسنا .. دعنا نعود لهذه النقطة البدائية للكون .. تلك النقطة التي كان كل شيء نعرفه اليوم فيها مضغوطا !!!.. من المكان إلى الزمان إلى الطاقة والقوى الأساسية الأربعة : الكهرومغناطيسية والجاذبية والنووية الضعيفة والقوية .. السؤال الذي أعيده عليك مرة أخرى الآن أستاذ هشام : ولعلك تلتفت إلى كل كلمة فيما سأقوله هذه المرة لتوافقها مع سياق مسألتك .. السؤال هو : ((((مَن)))) الذي بذل شغلا خرافيا بصورة لا يتخيلها أحد : لكي يضغط كل هذه الأشياء مع بعضها البعض ؟!!!!!!.. إذا قلت أن هناك أحد : أقول : وهذا ما ندين الله تعالى به !!!.. فنحن نعترف له بالخلق والتصريف وبالقدرة التامة !!!.. وإن قلت لا أحد : أقول لك : وهذا أول ما يناقض يناقض 1- البديهيات 2- السببية 3- استحالة تسلسل الحوادث إلى ما لا نهاية 4- الانتروبي وقوانين اتزان الثيرموديناميك !!!.. ولنترك 1 و 2 و3 : ودعنا نتحدث عن4 : لأن التأمل فيها يهدم عقيدتك في ثبات القوانين وخصائصها (أزلا ً) !!!.. أقول - ولتبسيط الأمر للقاريء العادي - : نحن عندما نضع نقطة حبر في كوب به ماء : نجدها في باديء الأمر تحتل مكانا محددا في موضع سقوطها في الكوب .. ثم - ومع الوقت - تبدأ في الانتشار العشوائي في الكوب : حتى تملأه بانتظام تقريبا - أي نفس الكمية تقريبا في كل جزء من الكوب - والسؤال الآن : هذا الانتشار دوما -والذي ينطبق على الغازات والسوائل والحرارة إلخ - يحدث بتلقائية القوانين الفيزيائية والميل الدائم لها لزيادة الأنتروبي بطبيعتها (أي بخصائصها) والسؤال الآن : أين كانت هذه القاعدة وهذه الطبيعة : عندما تم تجميع وضغط كل هذه الصور الهائلة من الزمان والمكان والطاقة والقوى الأساسية الأربعة ؟!!!.. وهو ما يعود بنا للسؤال الذي قبله مرة ًأخرى أستاذ هشام : (((مَن))) الذي بذل (((شغلا ً))) جبارا ًليضغط كل ذلك في هذه النقطة الصغيرة المفترضة لبداية الكون ؟!!!.. وأما تعليقي على كل ذلك حتى الآن فهو : ألا ترى معي أستاذ هشام أنه سواء كانت المادة مستحدثة عند هذه النقطة من ولادة الكون الذي نعرفه : أو كانت المادة سابقة له : ألا ترى معي (منطقا وعقلا وعلميا) أنها تصرخ بأن من وراءها في كلتا الحالتين (فاعل) ؟!!!.. إما فاعل قد خلقها من عدم .. وإما فاعل قد نقلها من حال الانبساط إلى حال الضغط الرهيب إلى حال الانبساط والتمايز ؟!!!.. وهنا نقطة أخيرة وهي : هل في رأيك أستاذ هشام خصائص المواد (ولن أقول مادة بصيغة المفرد لأن ذلك أدى إلى سطحية كبيرة في التعامل مع المفهوم) أقول : هل في رأيك خصائص المواد (ماء - حديد - هيدروجين - كربون إلخ) : هي أشياء (معنوية ليس لها جسد - أي إدراك عقلي) ؟؟.. أم هي أشياء (مادية) ؟!!!!.. فإذا اخترت الأولى : فأنت تهرب من الإيمان بغيب المؤمنين إلى إيمان بغيبك الخاص الذي ليس عليه دليل !!!.. وإذا قلت هي أشياء مادية : فهذه ما لن تجد أحدا يوافقك عليها : فضلا عن طرافة تصور صفا طويلا من الخصائص (كأنهم أشخاص واققفون - رجال مثلا ً) : وأمامهم صفا طويلا من المواد (وكأنهم نساء مثلا ً) : ثم يتم تقديم خاصية من هنا (رجل) : إلى مادة من هنا (امراة) كيفما اتفق !!!.. بحيث (صادف) مثلا ًان يكون لـ (مادة) (أو امرأة) الحديد : (خاصية) المغنطة والجذب (كرجل) !!!!.. والتخيل الآن : هل هناك ما يمنع حسب هذا السيناريو في توزيع الخصائص على المواد قبل تشكلها بالانفجار الكبير : أن تكون المغنطة من نصيب النحاس أو الصوديوم إلخ إلخ ؟!!!!!.. وأن تكون الميوعة من نصيب الحديد - وهو بارد وليس منصهر - فيصير أقرب للزئبق ؟!!!.. أترك لك الإجابة على كل ذلك أستاذ هشام .. وأرجو منك الصدق مع نفسك لأني احترمت فيك تتبعك للمنطق .. وللعلم : العلماء الملاحدة أنفسهم أغرقوا بعضهم البعض في بحار من التخيلات والافتراضات النظرية - أو الفلسفية بالأحرى - عن أكوان موازية وأوتار إلخ إلخ : والتي لن يمكن التثبت منها أبدا ً: فقط ليهربوا من ((((بساطة)))) الاعتراف بالخالق عز وجل !!!.. وأما العجيب الذي أخصك به هنا من محاولاتهم تلك : أنهم - وبأنفسهم - افترضوا إمكانية وجود ((قوانين)) أخرى تحكم تلك العوالم المتوازية بقواعد وثوابت مختلفة إلخ إلخ إلخ !!!.. وسبحان الله العظيم على الكبر وما يفعله بصاحبه !!!.. يجعله يقول القول : ثم ينقضه ولو بعد حين !!!.. تماما مثلما أعلن ستيفن هاوكينج في 1970م مع زميله بنروز : أنه هناك نقطة تفرد لهذا الكون Singularity : ثم عاد فنقض تلك الحقيقة بالتمويه عليها وإدخالها في مستنقع النظرية M ومفهوم الكون الذي (بلا حدود) !!!.. عجيب !
    ---------------

    15...
    ....### ثانيا ### وهو تلخيص لما وصل إليه نقاشنا الآن أستاذ هشام - من وجهة نظري - حول الدليلين 1 و 2 الذان اخترت أنت التعليق عليهما من الأدلة الـ 6 التي عرضتها عليك .. فأما الدليل 1 : والذي عرضت عليك فيه مثالا لاستحالة تسلسل الحوادث إلى ما لا نهاية وإلا : فلم يكن ليحدث شيء !!!.. وهذا من العبث بمكان لأنه يعني أني ولا أنت موجودين الآن .. وإنما يلزم مُحدث أول قديم أزلي ليتم الخلق والحدوث : ويكون أصل ذلك المُحدث لغيره أنه موجود - أو هو أصل الوجود - وليس بحادث .. ولا يسبقه شيء .. فكان ردك أستاذ هشام أنك لم تقدم اعتراضا على ذلك وإنما حولت نقاشك من الدليل1 إلى الدليل 2 وهو : أنك تثبت أن المادة وقوانينها أزلية الوجود !!.. وهنا : وافقتك على ترك مناقشة الدليل 1 : لأنك أقررت بالفعل على (ضرورة) وجود ((أزلي)) في الوجود .. وانحصر بذلك الخلاف بيننا في (تحديد) ذلك الأزلي .. هل هو (خالق حكيم مريد عليم قادر إلخ) ؟؟.. أم (مادة صماء عجماء يُخضعها الإنسان في معمله لقوانين تلزمها ولا تنفك عنها) ؟!!.. فاخترت أنا الاختيار الأول : ولم أتوسع في أدلته لأنها تندرج تحت باقي الأدلة الستة التي عرضتها عليك (ومنها دليل الإحكام الرهيب في خلق المخلوقات وما صار يندرج تحته اليوم ما يعرف بعلامات التصميم الذكي والتي يستحيل ظهورها صدفة أو بغير غاية مسبقة) .. واكتفيت بعرض بعض الحقائق واعترافات العلماء - حتى الملاحدة منهم - على الضبط الفائق لقوانين الكون التي تدل على أنه من ورائها (خالق حكيم مريد يعلم ما يفعل) : وليس مجرد (مادة صماء لا وعي لها ولا غاية !) .. فوجدتك بالغت في محاولة التدليل على أزلية المادة وقوانينها التي لا تنفك عنها .. فواجهتك بأن كلا المادة وقوانينها : هما حادثين من بعد الانفجار الكبير !!.. وأنه قبل زمن بلانك لم يكن للمادة ولا للقوانين والثوابت الرقمية التي بها أي معنى !!!.. وحتى ظهور الجسيمات الافتراضية من الفراغ الكوانتي أقول : الفراغ الكوانتي وكفضاء : هو أيضا حادث من بعد الانفجار الكبير !!!.. فماذا بعد ؟؟.. وماذا فعلت أستاذ هشام ؟؟.. لقد خرجت علينا بأنك تقصد أن (خصائص) المادة : هي موجودة أزلا ً!!!.. وأينما وجدت المادة : تركبها خصائصها وتلازمها (أوتوماتيك) - هكذا فهمت وهكذا فهم القاريء العادي - !!!.. ومن هنا قمت بتفنيد كل ذلك لك في مداخلتي السابقة .. لنعلم أن المغالطة هي في وضعك للحصان خلف العربة : والصواب العكس !!!.. فالقوانين لا تنتج لنا موادا أستاذ هشام !!.. فقولنا 1 تفاحة + 1 تفاحة = 2 تفاحة : هو قول نظري .. وليس معنى قولنا له : أننا بذلك نكون قد أوجدنا 2 تفاحة ماديا بالفعل !!!.. هذا عن القوانين .. وأما عن خصائص المواد : فكلا من الخصائص والمواد : تحتاج لفاعل !!!.. الخصائص تريد مَن يخصصها - لأنه طالما هناك أكثر من اختيار للخصائص إذا ًهناك مَن اختار بينها ليربط كل خاصية اختارها وحددها بمادة بعينها - والمواد تريد مَن يخلقها ويختار لها خصائص (معينة) من بين خصائص كثيرة وبدائل !!.. وهكذا نجد أننا لم نبتعد عن معضلة استحالة تسلسل الحوادث !!.. إذ أنك - ومهما - وضعت بديلا عن الله تعالى : ستجده متغيرا وحادث : مما يعني أنه هناك مَن قبله !!.. ولن يوجد حل إلا في الأزلي المطلق سبحانه : والذي تتوافر فيه كل بديهيات ومنطقيات وعلوم الحقائق !!!.. من حكمة وعلم وقدرة وأزل وإرادة وفعل إلخ .. فهل تميل إلى هذا الرأي (أخيرا) أستاذ هشام (وعن اقتناع تام) ؟؟.. أم لديك لا زلت تشككات وشبهات وعراقيل ؟؟؟.. ولنتابع ردي على باقي ما أثرته من مسائل ..
    ---------------

    16...
    ....### ثالثا ### وهنا أتعرض بالرد على تخليطات ذكرتها أنت في معرض كلامك أستاذ هشام بين عدة مفاهيم دينية ومنطقية للأسف .. وكنت أحسبك أوسع اطلاعا من ذلك !!.. فأما الخلط الأول .. فمثاله قولك : "" ولهذا فإن المؤمن يطالب الملحد مثلًا بإثباتات "علمية" على نشوء أول خلية حيّة، وقد لا يجد نفسه مقتنعًا أمام الفرضيات العلمية المقترحة في نظرية الأبيوجينيسيس مثلًا، بينما نجده يقف بتسليم تام أمام عبارة "الله على كل شيء قدير" عندما يتعلق الأمر بالإيمان(!). "" وأقول : فأما عن مسألة " الله على كل شيء قدير " : فهذه عندنا لها مكانها في الاستدلال على (قدرة) الخالق : لا الاستدلال على (الإيمان) بالخالق !!.. والفرق كبير !!.. ومن الخلط وضعها في موضع الحجة الإيمانية أصلا بوجود خالق !!!.. بل في معرض الحجة الإيمانية بوجود خالق : فنحن نضع آيات كثيرة جدا قد خاطب الله تعالى فيها (عقل) الإنسان و(بداهته) !!!.. مثل قوله عز وجل في سورة الطور : " أم خــُــلقوا من غير شيء أم هم الخالقون " ؟!!.. وغيرها من آيات الخلق .. وهي واضحة الدلالة في أن الخلق الحقيقي وبإطلاقه : هو بيد الله وحده .. ولا يملك شيء لشيء في هذا الكون إيجادا من عدم : ولا إعدام موجود !!!.. وأيضا نفيه سبحانه لمعاني الشرك به عقلا مثل قوله في سورة المؤمنون : " ما اتخذ الله من ولد وما كان معه من إله إذا لذهب كل إله بما خلق ولعلا بعضهم على بعض سبحان الله عما يصفون " .. وغيرها من الآيات النافية للشرك .. إذا ًأستاذ هشام : الاحتجاج بآية " الله على كل شيء قدير " : ليس في قضية (أصل) الإيمان بالخالق وإنما : فيما تفرع عن هذه القضية الإيمانية الأولى !!.. بحيث لو صدقت الأولى وآمنت بها : تقبلت الثانية وهي أن ذلك الخالق العظيم بالفعل سبحانه : هو على كل شيء قدير ؟؟!!.. وهذا بالضبط ما وضع الله تعالى فيه سياق مثل هذه الآيات : فلا مجال هنا للخلط أستاذ هشام رجاءً !!!.. يقول تعالى في سورة الإسراء : " أولم يروا أن الله الذي خلق السماوات والأرض قادر على أن يخلق مثلهم " .. فهنا قدم أولا دلائل قدرته الملموسة : ثم رتب عليها الإيمان بالقدرة المطلقة لمَن فعل الأولى : أن يفعل الثانية !!.. وهذا الاستدلال قمة في المنطق أستاذ هشام .. أم لا تتفق معي ؟؟.. إذا ًالخلاصة .. لن تجد إنسانا ًمسلما ًيجادل ملحدا ً: فيسأله الملحد عن ((دلائل)) وجود ((الخالق)) عز وجل : فيقول له المسلم : " الله على كل شيء قدير " !!!!.. وإنما سيستخدم آيات أخرى ... ومن هنا ننتقل إلى خلط آخر وقعت فيه أستاذ هشام للأسف - ولم أكن أحسبك تقع في مثله - وهو : ادعاءك أن الإيمان بالغيب : يقتضي الإيمان بالله تعالى بغير أدلة محسوسة !!!!.. وهو ما أشرت أنت له بقولك : "" وإذا كان المؤمن (لاسيما المسلم) يعتقد أنَّه توجد أدلة "علمية" تثبت وجود الله، فهو بكل بساطة يقدح في عقيدته القائمة على ضرورة الإيمان بالغيب، ولقد ركزت الآيات القرآنية كثيرًا على أهمية الإيمان الغيبي هذا، فنقرأ مثلًا: {الذين يُؤمنون بالغيب ويقيمون الصلاة ومما رزقناهم ينفقون} "" أقول .. لو كان مفهومك للإيمان بالغيب أستاذ هشام يعني الانسياق وراء أي (فكرة) دينية بغير تمحيص ولا استدلال : لكان كل إنسان هو (على حق) في نظر الإسلام !!!.. ولكان النصراني على حق !!.. واليهودي والمجوسي والصابيء إلخ إلخ إلخ ..! أقول : وهذا خطأ !!.. إذ الإيمان مبناه العقل .. وإلا : فما أهمية عشرات الآيات في القرآن التي يتحدث فيها الله تعالى عن دلائل خلقه للمخلوقات وإبداعها وهدايتها بالغرائز والفطرة وتصريفاته في كونه ؟!!!.. من البحر والبر : للسماء والسحب والأفلاك والنجوم ؟؟!!.. ومن المخلوقات والنباتات والحيوانات ومختلف الكائنات : إلى الملائكة والجن والإنسان ؟!!.. ومما يصعب حصره الآن !!!.. إذن .. الإيمان بالغيب أستاذ هشام : معناه الإيمان بوجود الله تعالى يقينا جازما وعلما راسخا في القلب والنفس والعقل : رغم أني لم أره ولم ألمسه !!!.. فهذا هو معنى الإيمان بالغيب هنا .. وليس معناه أني أؤمن (بوجود) الله من غير دليل !!!!!!!!.. عجيب !!.. ولذلك فقد تم ترتيب مراتب اليقين كما جاءت في القرآن على ثلاث مراتب : 1- علم اليقين (كأن أستدل بشواهد كثيرة أكيدة على وجود مشروب اسمه العسل مثلا : ولم أكن أعرفه من قبل) 2- عين اليقين (وهو أن أرى ذلك العسل بنفسي أمامي بالفعل) 3- حق اليقين (وهو أن أشرب ذلك العسل بالفعل فيتحقق فيه كل ما علمته ورأيته من قبل) .. إذا ًأستاذ هشام : ففرق الإنسان المؤمن عن الملحد : أن المؤمن يستخدم عقله الذي وهبه الله تعالى له في الاستدلال بدلائل على وجود شيء : لم يره !!.. وأما الملحد : فبرغم أنه يفعل نفس الشيء في حياته اليومية (فتجده يستدل على مرور سيارة من آثار إطاراتها ويستدل على وجود صانع للتلفاز بالنظر في إحكام صنعته ورغم أنه لم يره إلخ) : وكل ذلك إيمان منه بالغيب الذي لم يحضره ولم يره بعينه ولكنه عندما يتعلق الأمر بالله تعالى : يستنكر الملحد ساعتها الاستدلال والإيمان بالغيب وكل البديهيات !!!..
    ---------------

    17...
    ....### رابعا ### وأما ما أثار عجبي أستاذ هشام منك صراحة : فهو تساؤلك الغريب التالي إذ قلت -واسمح لي بالاقتباس المطول من كلامك - : "" في اعتقادي الشخصي يا عزيزي فإنَّ قضيَّة وجود أو عدم وجود خالق هي قضية ثانوية وليست مهمَّة على الإطلاق، فمن السفه أن يبذل أحدنا جهدًا ووقتًا في سبيل البحث حول "من هو مخترع سيارة تويوتا" والبحث عن السيرة الذاتية لهذا المخترع ومعرفة أدق التفاصيل عن حياته وسماته الشخصية وأكلته المفضله وأين كان يقضي عطلته الأسبوعية، فهذه المعلومات (رغم أنها قد تكون مفيدة من حيث كونها معلومات عامة لا أكثر) إلا أنها في الحقيقة لا تخدم في كثير أو قليل في استفادته الشخصية من سيارته التويوتا التي يرغب في شرائها، وبالتأكيد فإنها ليست معلومات مطلوبة في كلية الهندسة قسم الميكانيكا، أو أي معهد فني لميكانيكا السيارات، فبالإمكان فعلًا أن يصبح أحدنا مهندسًا ميكانيكيًا بارعًا دون أن يُلم بهذه المعلومات، وربما يبرع أحدنا في صيانة سيارات التويوتا دون أن يضطر لمعرفة اسم مخترع السيارة أصلًا، فالمهم (في هذه الحالة) هو معرفة القوانين والمبادئ الأساسية في ميكانيكا السيارات وكيفية عمل المحركات. فسواء عرفنا أن مخترع تويوتا هو كيشيروا تويودا أم لم نعرف؛ فالحقيقة أنَّ سيارات تويوتا موجودة، وهذا هو المهم، ولكن سوف يصبح من الأهمية بمكان معرفة اسم هذا المخترع، لو اكتشفنا أنَّه صمم سياراته بحيث تكون قابلة للانفجار عند سرعة (120كلم/ساعة) حتى نتمكن من محاسبته قانونيًا لما تسبب به اختراعه هذا من وفاة مستخدميها، حتى لو عرفنا لاحقًا أنه فعل ذلك بقصد الحد من تجاوز هذه السرعة لخطورة القيادة بسرعة جنونية(!) "" أقول : الذي جعلك (اهتممت فجأة) بمعرفة اسم الصانع لمحاسبته : كان يمكنك أن تفترض في نفس مثالك شيئا آخرا يبعثك على معرفة الصانع واسمه : ولكن ليس لمحاسبته هذه المرة كما افترضت أنت ولكن : لأنه هو الذي سيحاسبك وكما نفترض نحن !!!!.. إذ : تخيل أنك تشتري سيارة تيوتا وتجد مكتوبا عليها تحذير عن كذا وكذا والسرعة كذا والحزام كذا والمرآة كذا إلخ : وإذا خالفت كل ذلك فإن صاحب السيارة - أو منتجها أو مخترعها - سيعاقبك : وهذا شرط لتركب سيارته رغم أنه ملكك إياها !!!.. إذا ً: قضية معرفة الخالق والصانع هي محورية أستاذ هشام : بمعرفة الزاوية التي تنظر إليها !!!.. وهنا لا يسعني إلا أن أقول : سبحان الله العظيم ..! أنت لا ترى في الدنيا والحياة إلا صنعة ًتحاكيها وتستفد منها : رغم أنك تنسبها للصدفة العمياء أو المادة الصماء !!!.. أولست تجد ذلك غريبا أستاذ هشام ؟؟.. أن تجد العلماء (يلهثون) في دراسة مخلوقات ومنتوجات (الصدفة والعشوائية) : بدءا ًمن قوانين كونية وثوابت غاية في الدقة والإحكام : وانتهاءً بمخلوقات حية تحتوي ما صار يقتبس منه العلماء الأفكار ويحاكونها في إعجازات خلقها وخصائصها (التوجيه بالموجات الصوتية مثل الحوت والدولفين والخفاش ! عمل وهندسة السدود من القندس ! مقاومة البرودة الرهيبة من الدب القطبي والبطريق ! الطيران وتقنياته من الطيور والحشرات ! التوليد الكيميائي للكهرباء والإضاءة بأقل التكلفة من الحشرات المضيئة ! إلخ إلخ إلخ ولو جلست لأعدد للصباح لن أستطيع الإيفاء) !!.. فهل لا ترى كل ذلك غريبا أستاذ هشام ؟؟!!.. أن يكون هدفك من الحياة والدنيا أن تدرس وتستفيد وتحاكي : ما صنعه الله تعالى أصلا ًلك : ليدلك عليه من جهة : وليفيدك من جهة : فانشغلت بالهدية عن الذي أهداها إليك !!!.. فهل تعتبر ذلك من مكارم الأخلاق أستاذ هشام ؟؟؟.. أن أحضر لك هدية (سيارة مثلا ً) : فلا تشكرني ولا تهتم حتى بمعرفة اسمي ولا من أنا ولا لماذا أهديتك ولا ولا ولا : ويصير كل همك فقط الانتفاع بالهدية ودراستها ومحاولة عمل مثلها !!!!.. اللهم حسن خلقنا وأخلاقنا بالإيمان يا كريم ...
    ---------------

    18...
    ....### خامسا ### : يقول الأستاذ هشام في بادرة خير قد كررها أكثر من مرة : وأرجو أن يبت فيها أخيرا ً(عن قناعة) : "" ولكَ أن تُصدق يا عزيزي أنَّه ورغم قناعتي بأزلية المادة مثلًا، إلا أنَّ هذا لا يُشكل (بالنسبة إليّ) أي إثبات حقيقي لنفي وجود خالق؛ بل على العكس تمامًا فإنَّ أزلية المادة قد تكون مبررًا لوجوده، فهي قد تبرر لفاعلية الذات الإلهية (الخالق) في الأزل؛ على أنَّ هذا الأمر كذلك ليس يقينيًا "" :أقول : هو بالفعل ليس يقينا أستاذ هشام : لأن الأزلي واحد فقط هو الله سبحانه .. وأما فرضك لقدم مخلوقاته معه : فهو لا يتعدى مفهوم المالانهاية - 1 !!!.. فالله تعالى هو الأول وليس قبله شيء .. أعود فأقول : نحن لا نريد منك أستاذ هشام أن (تسايرنا) في مسألة وجود (خالق) !!.. فما أسهل من أن أقول لك (ومن أول مداخلة عندما رأيتك تميل للحوار عن الألوهية أكثر من الربوبية) : أن أقول لك : حسنا أستاذ هشام : فلنتحدث عن الألوهية ولنتجاوز عن الربوبية والاعتراف بخالق من عدمه أو نضعها جانبا الآن !!!.. أقول : لم و(لن) أفعل ذلك أستاذ هشام : لأني أثق في عقلك وأنك تستطيع تمييز الحق الظاهر من الباطل الظاهر !!.. ووالله : لو جلست لعدد غير محدود من السنوات لتقنع عاقلا بأن مادة مجموعة في نقطة ثم توزعت وتفرقت وتفتت (هكذا بغير فاعل جمعها ولا فاعل شتتها) : ثم في تفرقها نراى كل مجموعة منها تجتمع من جديد (مجرات - مجموعات - نجوم) لتنضغط المواد فيها وتتباعد وتنضغط وتتباعد - ومع كل انضغاط وتجمع تحتاج لفاعل ولشغل - : ومن غير فاعل أيضا : ما صدقك !!!.. ومن هنا أشير لك أستاذ هشام إلى معنيين هامين وهما : الممكن والمستحيل !!!.. فنحن - كمؤمنين - نؤمن بغيب : ممكن (لأننا نؤمن بخالق حكيم عليم مريد قادر أخفى نفسه عنا : وذلك ممكن) .. وأما أنت - وكل منكر للخالق - فيستبدله بإيمان بغيب ولكنه : مستحيل (لأن كل غيب الملاحدة يحطم البديهيات المنطقية والعقلية تحطيما .. وهي للتقريب تساوي من يقول : 1+ 1 : لا تساوي 2) !!!.. والله المستعان ....### سادسا ### وهو تعليق سريع على طعنك - على الهامش - في نظرية التصميم الذكي ودفاعك في المقابل عن نظرية النشوء والارتقاء .. أقول : بالنسبة للتصميم الذكي : فهي لا تعتمد على رفض أزلية المادة كما تتصور أستاذ هشام !!.. ولكنها تعتمد على مجموعة من الأدلة (الدامغة) التي تنفي ظهور الكون والمخلوقات (صدفة) أو من مادة (صماء) لا عقل لها !!!.. وهذه الأدلة التي تعتمد عليها نظرية التصميم الذكي كثيرة .. منها التوافق الدقيق للكون .. والتعقيد الغير قابل للاختزال .. والتعقيد المتخصص إلخ .. ودعني أعطيك مثالا أو اثنين أو ثلاثة أو حتى أربعة - ولاحظ أنك لم تعلق أو تعقب على ما نقلته لك سابقا من التوافق الدقيق للكون ! - 1 المثال الأول : هو في تكامل التزاوج بين الرجل والمرأة !!.. هل يمكنك أن تنفي الغائية المسبقة في كل تفصيلة معجزة من تفصيلاته ؟!!.. بدءا ًمن تركيب الحيوان المنوي والبويضة وآليتهما لإتمام التلقيح : ومرورا بميكانيزم الحركة والتغذية إلى الرحم وفيه : وانتهاء بالتخليق المعجز للجنين والتباين المذهل لخلاياه : كل ٌفي مكانه الذي كتبه الله له : ثم الولادة وما فيها ؟؟!!.. 2 المثال الثاني : ظهور اللبن لرضاعة الوليد في الثدييات ؟؟.. - هل تعرف أن بعض دعاة التطور قالوا أنه تطور عن العرق ولحسه !.. 3 المثال الثالث : الأجنحة في الطيور : والتي يستحيل تطورها تدريجيا بآليات التطور الهزلية الخيالية لأنها ساعتها ستنقض نفسها بنفسها لأنه سيُفترض ساعتها القضاء على الجناح لعدم فائدته قبل اكتماله !!!.. إذا ً: إما أنه ظهر فجأة وأبقاه الانتخاب الطبيعي لفائدة الطيران : وإما أنه تدرج في التطور : وساعتها لم يكن ليستمر لأنه لا فائدة للجناح ما لم يكون مكتملا كله مرة واحدة !!!.. 4 المثال الرابع : التعقيد الرهيب في الحمض النووي والذي أعجز أعتى الملاحدة - كأنتوني فلو إن كنت سمعت عنه - .. والمعضلات بالعشرات التي يطرحها في وجه الصدفة والإلحاد !!!.. وإلا : كيف يتم ترجمة لغة الشيفرات والجينات وفهمها على أنها أوامر لها معاني : وهي في الحقيقة مجموعة من المركبات الكيميائية والعناصر التي لا معنى لها ؟!!.. مَن الذي وضع تلك المعاني والشيفرات للدرجة التي يعترف بها ريتشارد داوكينز نفسه بأنه قد يقبل فكرة أننا من صنعة مخلوقات فضائية : قد نجد توقيعها بداخل الخلية الحية !!!.. - راجع فيلم المطرودون لو كنت تعرفه - أيضا : كيف ينشأ (بالصدفة) : نظام يعالج أخطاء نفسه بنفسه ؟!!!.. إلى آخر هذه النواسف لخرافة الصدفة من جذورها - لي موضوعين كاملين في نقض الصدفة والتطور لا أعتقد أنك ستسعد إذا نقلتهما لك هنا الأول باسم : هدم أسس الإلحاد .. والثاني باسم : ما يجب أن تعرفه عن نظرية التطور -
    ---------------

    19...
    ...### سابعا ### : وأما بالنسبة لتجربة يوري وميلر أستاذ هشام - ولا أعرف صراحة سر تمسكك بالاحتجاج بها رغم سقوطها منذ زمن وباعتراف التطوريين أنفسهم ! - أقول : لا بأس من سد هذا الطريق عليك أيضا - ولا تؤاخذني في دعابتي أحيانا في الكلام لتخفيف حدة الحوار - أقول : أول دحض يدحض دفاعك عنها : هو أنك تحججت بأن (فشلها) كان بسبب نقص المعلومات عن جو الأرض ساعتها : وأقول لك : قد مضى على التجربة اليوم يا أستاذ هشام ما يقارب الستون عاما تقريبا (1953 - 2013) والسؤال : وطالما قد عرف العلماء الجو الأقرب لجو الأرض حينها وبعكس ميلر : لماذا لم يتم تكرار التجربة وإعلان نجاح تكون (بروتينات أو بوليمرات) حقيقية مما تعرفه أبسط مكونات الخلية الحية ؟؟!!!.. ولو حتى بروتين متوسط التعقيد ؟؟؟.. لماذا خزلتهم الصدفة يا أستاذ هشام دوما - وإلى اليوم - ؟؟؟.. وهنا .. وقبل أن أجيبك أنا - عمليا - ببيان استحالة تكون بروتين متوسط صدفة - وبالأرقام التعجيزية - أحب أن أنقل لك النقلين التاليين : النقل الأول هو من عدد فبراير 1998م من مجلة الأرض EARTH المعروفة أصلا بمناصرتها لنظرية التطور : حيث نشرت التصريحات التالية في مقالة بعنوان بوتقة الحياة : "يعتقد الجيولوجيون الآن أن الجو البدائي قد تكوّن في معظمه من ثاني أكسيد الكربون والنيتروجين، وهما غازان أقل تفاعلاً من تلك الغازات التي استُخدمت في تجربة عام .1953 وحتى إذا أمكن لجو ميلر أن يحدث، كيف يتسنى لك أن تجعل جزيئات بسيطة مثل الأحماض الأمينية تمر بالتغيرات الكيميائية اللازمة التي ستحولها إلى مركّبات أكثر تعقيداً أو بوليمرات مثل البروتينات؟ ميلر نفسه عجز عن حل ذلك الجزء من اللغز، وقد تنهد قائلاً بسخط: »إنها مشكلة«؛ »كيف تصنع البوليمرات؟ لا يتم هذا الأمر بكل هذه السهولة " !!!.. المصدر - Earth, «Life’s Crucible», February ,1998 p.34 .. وأما النقل الثاني : فهو من عدد مارس من مجلة »ناشيونال جيوغرافيك« حيث نشرت مقالة بعنوان «ظهور الحياة على الأرض : جاء فيها اعترافهم : " إن العديد من العلماء الآن يشكّون في أن الجو البدائي كان مختلفاً عمّا افترضه ميلر في البداية. إنهم يعتقدون أنه كان متكوّنا من ثاني أكسيد الكربون والنيتروجين بدلاً من الهيدروجين والميثان والأمونيا. وهذه أخبار سيئة للكيمائيين؛ فعندما يحاولون أن يشعلوا شرارة في ثاني أكسيد الكربون والنيتروجين، سيحصلون على كمية تافهة من الجزيئات العضوية تكافئ إذابة قطرة من ملوّن طعام في ماء بركة سباحة. وهكذا يجد العلماء صعوبة في تخيل أن الحياة قد نشأت من مثل هذا الحساء المخفف " !!!.. المصدر - National Geographic, «The Rise of Life on Earth», March ,1998 p.1.68 .. والآن .. تعال معي أستاذ هشام لأعرض عليك - إن لم تكن تعرف - معضلة تكون البوليمرات أو البروتينات التي اعترف ميلر بعجزه أمامها !!!.. أقول .....
    ---------------

    20...
    توجد ثلاثة شروط لتكوين بروتين مفيد (والبروتينات هي الوحدة الفاعلة في الخلية ونشاطها الحيوي) :الشرط (1) أن تكون جميع الأحماض الأمينية في سلسلة البروتين هي من النوع الصحيح وبالتتابع الصحيح .. الشرط (2) أن تكون جميع الأحماض الأمينية في السلسلة هي يسارية الرابطة (عسراء) ..الشرط (3) أن تكون جميع هذه الأحماض الأمينية متحدة فيما بينها من خلال تكوين ترابط كيميائي يسمى "ترابط الببتايد" .. والآن .. تعالى معا لنرى احتمالية كل شرط من الشروط الثلاثة السابقة ثم مجموع الاحتمالات الثلاثة معا .. فإذا أخذنا مثلا جزيء متوسط يحوي 500 حمض أميني فقط : فاحتمالية الشرط (1) وهو أن تكون الأحماض الأمينية موجودة بالتتابع الصحيح : فيوجد لدينا عشرون نوعاً من أنواع الأحماض الأمينية تُستخدَم في تركيب البروتينات .. إذا ًاحتمالية أن يتم اختيار كل حمض أميني بالشكل الصحيح ضمن العشرين نوعاً هذه = واحداً من 20 .. وعليه تكون احتمالية أن يتم اختيار كل الأحماض الخمسمائة بالشكل الصحيح = (1/20) أس 500 = 1/(10 أس 650) ...! وأما احتمالية الشرط (2) وهو أن تكون الأحماض الأمينية كلها يسارية الرابطة (عسراء) = احتمالية أن يكون الحمض الأميني الواحد أعسر = 2/1 .. ثم احتمالية أن تكون جميع الأحماض الأمينية عسراء في نفس الوقت =(1/2) أس 500 = 1/(10 أس 150) ...! وأما احتمالية الشرط (3) وهو اتحاد الأحماض الأمينية بترابط الببتايد : فمن المعلوم أن الأحماض الأمينية تتحد معاً بأنواع مختلفة من الترابطات الكيميائية.. ولكي يتكون بروتين مفيد : فلا بد أن تكون كل الأحماض الأمينية في السلسلة قد اتحدت بترابط كيميائي خاص يسمى "ترابط الببتايد" .. ويتضح من حساب الاحتماليات أن احتمالية اتحاد الأحماض الأمينية بترابط كيميائي آخر غير الترابط الببتيدي هي خمسون بالمئة .. وفيما يتعلق بذلك تكون احتمالية اتحاد حمضين أمينيين بترابطات ببتايدية = 1/2 .. وتكون احتمالية اتحاد جميع الأحماض الأمينية بترابطات ببتيدية = (1/2) أس 499 = 1/(10 أس 150) ...! وهكذا تكون المحصلة النهائية للاحتمال الكلي لتكون بروتين متوسط (صدفة) = 1/(10 أس 650) × 1/(10 أس 150) × 1/(10 أس 150) =1/(10 أس 950) !!!!.. وهو يعني الرقم مليار (يعني ألف مليون) : مضروبا في نفسه 105 مرة (أي 105 مليار مرة !!) .. وهو رقم مذهل .. ولو استخدمنا مليارات المليارات من الكمبيوترات بسرعات مذهلة لمحاكاة هذه الاحتمالات : فلن يكفيها عمر الكون كلّه لإنتاج بروتين واحد بالصدفة !!.. أي حتى لو افترضنا يا أستاذ هشام أن المحاولات تتمّ بسرعة تساوي سرعة الضوء (أي بمقدار 300 مليون محاولة في الثانية الواحدة) : فإن هذا لن يغير شيئا ًذا قيمة في هذا الرقم الرهيب الذي معنا ..! حيث فقط : سيقل عدد المليارات المضروبة في بعضها من السنوات : بمقدار مليار واحد !!!!.. بل .... سنفترض أننا نستخدم جهاز كمبيوتر لمحاكاة هذه العملية : وأنه يعمل بسرعة مليار جيجا هرتز (أي مليار مليار نبضة في الثانية الواحدة) : وهو الغير موجود أصلا ً : وسنفترض أن كل نبضة : ستـُحسب احتمالا ً(وهذا مستحيل بالنسبة لعمل الكمبيوتر : ولكننا سنفترضه) .. فالعجيب : أن هذا أيضا لن يُغير شيئا ذا قيمة في الرقم الرهيب الذي حصلنا عليه ..! حيث سيقل فقط عدد المليارات المضروبة في بعضها بمقدار : مليارين اثنين !.. أي أننا ما زلنا نتكلم عن أزمان : خارج حدود هذا الكون أصلا ًذي الـ 15 مليار سنة في العمر تقريبا !.. فكيف به إذا قارناه بعمر الأرض والذي يقدره العلماء بحوالي 4.6 مليار سنة فقط ؟؟!!!.. هذا كله : لاحتمالية تكون بروتين واحد فقط صدفة : من النوع الوسطي وليس من البروتينات الطويلة أو المعقدة !!!.. فماذا لو أردنا أن نحسب بروتينات بكتيريا واحدة بسيطة (صدفة) كما تدعي أستاذ هشام ؟؟.. أقول : قام روبرت شابيرو (أستاذ الكيمياء بجامعة نيويورك وأحد الخبراء في مجال الحمض النووي) بحساب احتمال التكوين العرَضي لألفَي نوع من أنواع البروتينات الموجودة في بكتيريا واحدة (حيث يوجد 200 ألف نوع مختلف من البروتينات في الخلية البشرية !) : فجاءت نتيجة الحساب كالآتي : (1 من 10 أس 40.000) ..! وهذا رقم هائل جدا ًهو الآخر (أكبر من الأول بأكثر من 40 مرة !!!) : ولا يمكن تخيله !!.. ويتم الحصول عليه بوضع أربعين ألف صفر : بعد الرقم 1 !!!.. المصدر - Robert Shapiro, Origins: A Sceptics Guide to the Creation of Life on Earth, New York, Summit Books, 1986. p.127 .. وكذلك قد أدلى تشاندرا ويكراماسنغي (أستاذ الرياضيات التطبيقية والفلك بالكلية الجامعية في كارديف - ويلز) بالتعقيب الآتي في نفس السياق : " تتجسد احتمالية التكوين العفوي للحياة من مادة غير حية : من احتمال واحد ضمن احتمالات عدد مكون من الرقم 1 : وبعده 40.000 صفر !!... وهو رقم كبير بما يكفي لـ : دفن دارون ونظرية التطور بأكملها !.. وإذا لم تكن بدايات الحياة عشوائية : فلا بد أنها قد نتجت عن عقل هادف " !!.. المصدر - Fred Hoyle, Chandra Wickramasinghe, Evolution from Space, New York, Simon & Schuster, 1984, p. 148
    ---------------

    21...
    ....### ثامنا وأخيرا ً### : وهو تعليق على كلامك الغريب جدا التالي أستاذ هشام - وكأنك لم تسمع من قبل عن إنجاز العالم باستير في التعقيم والبسترة !! والتي قضى بها نهائيا على خرافة نشوء الحياة من الجمادات أو خرافة التوالد التلقائي !!.. حيث كان يُظن مثلا ًأن الحشرات : تنشأ من بقايا الطعام !!.. ويُظن أن الفئران : تنشأ من الشعير !!.. ويُظن أن البكتيريا : تنشأ من الجمادات !!.. ويُظن أن اليرقات والديدان : تنشأ من قطع اللحم !!.. - فتقول يا أستاذ هشام : "" وعمومًا إمكان وجود حياة بقانون الصدفة هو أمر مُثبت فالطحالب وبعض المتعضيات وبعض أنواع البكتيريا والسرخسيات (اللابذرية) قد تنشأ فقط عند توفر الظروف المناسبة لوجودها، ولهذا قد نرى بعض الطحالب والحشائش في أحواض الغسيل وقد تنمو بعض السرخسيات على الجدران، وبالإمكان فعلًا أن تتحوّل المواد غير العضوية إلى مواد عضوية فما يُعرف بعملية التخليق الضوئي هو جانب تطبيقي لهذه الفكرة؛ فهذه العملية تقوم بتحويل المواد غير العضوية (الماء وثاني أكسيد الكربون) إلى مواد عضوية "" !!!.. أقول : بالنسبة لظهور الطحالب والسرخسيات والمتعضيات عند توافر الظروف : فلا تعليق يا أستاذ هشام على كلام ٍمضى على نقد دلالته على نشوء حياة من لا حياة يا رجل أكثر من 100 عام !!!!!!!!!.. فأنا عندما أهمل في نظافة بيتي : فأجد الصراصير والنمل والبق والعته وقد ظهرت في أرجائه : فلا أقول أن البيت قد خلق حياة ً!!!.. أو أقول أن توافر ظروف النتانة قد (خلقت) نملا وصراصيرا وبقا وعته !!!.. وكذلك الأمر إذا فقست بيوض الحشرات فوق المزابل بتوافر الغذاء ودرجة الحرارة : فلا أقول أن (الحياة) نشأت من الجماد !!!!.. فأرجو مراجعة معلوماتك جيدا يا أستاذ هشام رجاء .. وأما تعليقي الأخير : فأخصصه لتساهلك لأكثر من مرة في قولك بإمكانية تحول مواد غير عضوية إلى عضوية !!!.. أقول لك يا أستاذ هشام : إذا تأملت في مكونات الخلية من مواد : تجدها مثلها مثل باقي مواد الطبيعة ولا فرق : كربون نيتروجين فوسفات إلخ إلخ إلخ .. حسنا ً: ما (((أو مَن))) الذي بث في هذه التي بداخل الخلية الحية الوعي والإرشاد والهداية والإلهام : لتتصرف بأوامر - لاحظ أني أتكلم عن جزيئات كيميائية عضوية لا وعي لها - : فتتحرك بمقدار وتفهم وتقرأ وتميز بل : وتصحح لنفسها الأخطاء والنسخ وتستبدل وتستبعد إلخ إلخ إلخ ؟!!.. ألا ترى في ذلك إعجازا من خالق حكيم مدبر عليم يا أستاذ هشام ؟!!!.. ولنأخذ مثالا هنا الشيفرة الوراثية في الحمض النووي .. وسأسلك سؤالا - وكمثال فقط للتقريب - .. هل يمكنك قراءة الكلام التالي وفهم معناه وما أريد أن أقوله لك : xhlgh kl f,; dk'uH lhai `hjsH hd jpls ,g ؟؟.. هل فهمت منها شيئا ؟؟.. أعتقد أن لا .. حسنا .. لقد كتبت لك عبارة : " لو سمحت يا أستاذ هشام أعطني كوب من الماء " !!!.. ولكني كتبتها على لوحة المفاتيح بدون أن أغيرها إلى العربية !!!.. فإذا وضعت الحرف العربي المقابل لكل حرف إنجليزي على نفس الزر من لوحة المفاتيح : ستحصل على المعنى .. والسؤال هنا هو : كل الإعجاز الإلهي في الشريط الوراثي للكائنات الحية من أبسطها إلى أعقدها : هو بلغة الأربعة قواعد النيتروجينية ATGC .. حيث عند فرده لقراءة تتابعاته وأوامره : نجده كالتالي مثلا ً:AATGGCTAGGCTGAGCATTAGATCG وهكذا ... وهو ما أرهق الإنسان نفسه (العاقل !) ليفك عددا من شيفراته ومعانيها : هذه مختصة بلون العين : هذه مختصة بلون البشرة : هذه مختصة بسيولة الدم إلخ .. السؤال الآن لك أستاذ هشام : كيف يمكن للبروتينات وللجزيئات التي تتكون من ذرات مادية : لا عقل لها ولا وعي ولا حرية إرادة - لأن الإنسان يُخضعها بسهولة لتجاربه ولقوانينه في معمله- : كيف لها 1- أن تبدع هذا النظام من التشفير الرباعي (واختيار الرباعي هنا وحده له إعجاز لا مجال لذكره الآن) 2- فهم هذا التشفير !!!!.. 3- العمل بمقتضى أوامره ...! 4- تصحيح أخطائه عند النسخ !!!!!!!!!.. يقول عز وجل ربي وربك وخالقي وخالقك يا أستاذ هشام : " الذي أعطى كل شيء خلقه(أي هيئته وصورته وخلقته) ثم هدى (أي ثم هداه للتصرف بمقتضى تلك الخلقة) " !!!.. فهل ما زلت ترى أن هذا الكون والمخلوقات هي نتيجة الصدفة والعشوائية ؟؟.. أم أنك تنتقل إلى صف الربوبية (عن اقتناع) معنا الآن يا أستاذ هشام ؟؟؟..
    التعديل الأخير تم 03-10-2013 الساعة 12:37 AM

  6. #6

    افتراضي

    مناظرة مع الملحد هشام آدم بعنوان : وجود الله ..
    الجزء 3 ...
    جرت هذه المناظرة في جروب (نقاش فكري) على الفيسبوك ..
    وقد انتهت بانسحاب الملحد بأعذار أني أخطأت ولفقت ودلست فيها .. ولله الحمد ..!
    ---------------

    22...

    صدقني أنا أيضا أستاذ هشام .. أنا سعيد بهذا النقاش الذي يستعرض كافة الآراء المطروحه في المسألة والحجج التي يمكن ظهورها وكيفية الرد عليها وبيان خطأها عندي أو عندك .. فلا شك أن ذلك يصب في مصلحة القاريء العادي : إفادة وعلما .. وتصحيحا لوضعه ونظره تحت قدميه : أين يقف ؟؟.. وعليه .. فلي عودة إن شاء الله تعالى للرد .. ربما غدا مساء بإذن الله للانشغال .. والله الهادي


    ***

    الأستاذ هشام :
    عفوًا من الإدارة وعفوًا منك عزيزي أبو حب .... ما رأيك أن نعتبر هذه النقطة منتهية ونتجاوزها إلى النقطة التالية ... فكما تفضلتَ فإن الحوار طال كثيرًا ومازالت أمامنا خمس نقاط أخرى. أكرر اعتذاري عن هذا القفز
    ***


    لا مانع عندي أستاذ هشام .. ولكن بعد أن أكتب مداخلة واحدة - واحدة فقط - أعلق فيها على ما جاء في مداخلاتك الأخيرة سريعا كرأي مقابل رأي - إن كنت تعتبره كذلك وترحب به - وأشيد من جديد بأسلوبك المهذب في الحوار حتى الآن .. وطالما هي مداخلة واحدة : فقد أكتبها قبل مساء غد بإذن الله - ربما الليلة أو صباحا - ولكن ليس الآن لانشغالي .. وبعدها يمكنك اختيار ما تريد أنت النقاش فيه .. بالتوفيق
    ---------------

    23...

    الأستاذ هشام .. هذه المداخلة هي أشبه بتعليقات (شخصية) من طرفي على ما صدر منك حتى الآن .. فهي أشبه بالتقييم (الشخصي) الذي قد أصيب فيه أو أخطيء ولكني اترك الحكم للقاريء .. ولأنها موجزة : فلن أتطرق فيها لكثير التفاصيل والترجمة .. >>> لقد ذكرت لك الدليل الأول وهو (استحالة تسلسل الحوادث) : فقلبته أنت للحديث عن علاقة السبب والمسبب وهل هي (تجريبية) أم (اقتضاء عقلي) ! وعلى العموم : علاقة السبب بالمسبب هي من البديهيات المشاهدة بالتجربة ويقتضيها العقل الواعي للإنسان .. ويكفيني هنا انك أقررت بأزلية المادة وخصائصها وقوانينها بديلا عن الله ولكن : هل استطعت بالفعل التدليل على أزلية المادة يا أستاذ هشام ؟؟.. >>> لقد ذكرت لنا ظهور الجزيئات الدائم في الفضاء الكوانتي .. وربطت ذلك بمبدأ عدم التأكد لهايزنبرج : ومنه بنيت عقيدتك في عدم وجود (عدم) ولكن هو وجود أزلي للمادة في الفضاء .. أقول : وقد نسيت أنت هنا أنك بنيت هذا الحكم على ملاحظتك للفراغ الكمومي أو الفضاء الكمومي : والذي لم يظهر أصلا - ويا للعجب - إلا مع الانفجار الكبير !!!.. وراجع كلام العلماء في ذلك - حتى الملاحدة منهم - !!؟؟.. وإن أعجب : فأعجب للتبريرات اللا منطقية واللا علمية التي يتهرب بها الملاحدة من الاعتراف بذلك : ولكي يحفظوا على أنفسهم إنكار وجود الخالق !!.. حيث حاول بعضهم تفسير الظهور المُحدد والمفاجيء للمادة في اللازمان - لأن زمان كوننا لم يوجد ساعتها بعد - حاول تفسير ذلك بأنه ذبذبة كمومية حدثت في لحظة اللازمان !!.. مثل هذا الاقتباس مثلا :In the early 1970's Y. Zel'dovitch and A. Starobinski of the USSR along with Edward Tryon at Hunter College proposed that the universe emerged from a fluctuation in the vacuum. This vacuum fluctuation 'ran away' with itself, creating all the known particles out of empty space at the 'instant' of no-time !!!.. وعندما سُئل أحدهم : كيف تحدث ((ذبذبة)) كمومية في ((غير زمن)) ؟؟.. إذ أن أول مفاهيم الذبذبة هي تعلقها بوقت !!.. فكانت الإجابة الغريبة : The word 'fluctuation' simply means a change of some sort. We are most familiar with changes in time, but changes in space are also possible, although they are static in time!!.. >>> وقد سألتك يا أستاذ هشام فقلت لك : "" دعنا نعود لهذه النقطة البدائية للكون .. تلك النقطة التي كان كل شيء نعرفه اليوم فيها مضغوطا !!!.. من المكان إلى الزمان إلى الطاقة والقوى الأساسية الأربعة .. السؤال الذي أعيده عليك مرة أخرى الآن أستاذ هشام هو : ((((مَن)))) الذي بذل شغلا خرافيا بصورة لا يتخيلها أحد : لكي يضغط كل هذه الأشياء مع بعضها البعض ؟!!!!!!.. "" أقول : وسؤالي هنا كان في مقابل ادعاءك تارة بأزلية ((القوانين)) للمادة التي لم تظهر بعد !!!!.. ثم عدلت عنها في تارة أخرى لادعاء أزلية ((الخصائص)) للمواد التي أيضا لم تظهر بعد !!.. وعليه : فمفهوم كلامي كان : إذا كانت المواد (جمع مادة) لم تتمايز بعد : في حين قوانينها - والمعتمدة على ثوابت لم تظهر بعد - وخصائصها : كانت موجودة ((قبل)) الانفجار الكبير : فمَن ذلك الجبار الذي ضغط تلك (المواد) الأزلية ((وجودا وقوانينا وخصائصا)) في هذه النقطة الصغيرة الرهيبة : ثم قام بفصلها مرة أخرى ؟!!!.. وذلك لأن العلم يعرف ما يتطلبه ذلك من بذل شغل رهيب (لاحظ أني سألت عن مَن الذي بذل شغل : ولم أقل مَن الذي وضع نظام فالأول قدرة : والثاني حكمة) ؟!!.. فانتقلت أنت عن ذلك السؤال المحدد لتجيب بسؤال غريب وهو : "" حسنًا .. هل ضغط القوى الأساسية هو نظام أم فوضى؟ إذا قلتَ إنه نظام لتدلل به على أنَّ "فاعله" عاقل وذكي فإنَّ ذلك يعني أنَّ فك هذا الضغط فوضى، وبناءً على ذلك تتهاوى حجتك القائمة على الدقة المتناهية في الكون والقوانين، لأنَّ الدقة كانت متوفرة في الضفط المُنظم المقصود، وإذا قلتَ إنها فوضى فما الغريب إذن أن تنتج هذه الفوضى بمحض الصدفة دون "فاعل" عاقل وذكي؟ "" .. أقول : وحتى سؤالك بهذه الصورة مغالطة لا تلزمني لأني لم أقل بها أصلا ً!!!.. فأولا ً: أنا لا أقول بأزلية المادة : بل أقول أن الله تعالى هو الذي خلق المادة وزمانها وقوانينها من العدم !!!.. وإنما عندما أفترض عكس ذلك : فأنا أجاريك فقط في طرحك إمعانا لإقامة الحجة عليك حتى بفرض صحته !!.. ثانيا ً: سألتك عن مَن بذل (الشغل) فلم تستطع الرد : فنقلته أنت إلى سؤال عن (نظام أم فوضى ؟!) .. ومع ذلك ثالثا ً: أنت تسأل ثم تفترض إجابتين من عندك كلتاهما خطأ !!.. فأنت تقول مثلا ًإن كان الضغط الرهيب في نقطة بداية الكون كان بنظام : فإن فك هذا الضغط فوضى !!!.. أقول : ومَن أين أتيت بأن الفك الذي حدث هو فوضى ؟!!.. هل قلت أنا ذلك ؟؟!!.. لا .. هل التدقيق الرهيب في الكون باعتراف الملاحدة أنفسهم يقول ذلك ؟؟!!.. هل عندما أضغط ملفا على الكمبيوتر بنظام : هل يعني فك الضغط أنه سينفك بفوضى ؟!!.. لا .. إذا : أنت في الكثير من ردودك أستاذ هشام تجيب عن أشياء أنا لم أسأل عنها أصلا ولم يفترضها أحد إلا انت !!.. فهي أشبه بمغالطة رجل القش Straw man !!.. ولعل من أدل الدلائل على ذلك من جديد هو تهربك من أسئلتي عن تفسير كيفية النظام الرهيب في الخلية والغائية وتصحيح الأخطاء وظهور الشيفرة الوراثية : وذلك من ذرات وجزيئات : لا تعقل ولا تعي ولا حرية اختيار لها : إلى ((انتقاءك)) لصفة (الوعي) فقط : لتربط بها ردك !!.. في حين أني قلت - وبكل وضوح- : "" كيف يمكن للبروتينات وللجزيئات التي تتكون من ذرات مادية : لا عقل لها ولا وعي ولا حرية إرادة - لأن الإنسان يُخضعها بسهولة لتجاربه ولقوانينه في معمله - "" أقول : فربطي هنا للوعي بكل من (العقل) و(حرية الاختيار) : يدحضان كل محاولاتك لتفسير هذا النظام والإبداع والتصميم المذهل وتصحيح الأخطاء !!.. لأن كل هذه الإعجازات لا سبيل لتفسيرها إلا بشيئين : الأول : أن يكون هناك خالق هادي لها .. الثاني : أن تكون هي نفسها تعقل ولها حرية تفكير وإرادة (وليس مجرد وعي) !!!.. أما التفسير الأول : فأنت ترفضه كونك ملحدا تنكر الخالق إلى الآن !!.. وأما الثاني : فيدحضه أن الجسيمات والذرات لا حرية اختيار لها بالفعل والدليل : إخضاع الإنسان لها بكل آلية لتجاربه في معامل الفيزياء والكيمياء !!!.. حيث التجربة الواحدة إذا كررتها لآلاف المرات على الجسيم أو الذرة بنفس الظروف : تعطيك نفس النتائج ولا تتغير ! وهذا لا يدل على عقل وحرية اختيار قابلين للتفكير والإبداع حتى تنسب لهذه الجمادات هذه الإعجازات أستاذ هشام ؟!!.. وأخيرا ً: تجربة يوري وميلر : أنا أشبهها بتجارب الكيميائيين لإنتاج مواد داخل المعمل !!.. فأنت تضع مثلا كربونات الصوديوم مع هيدروكسيد الكالسيوم : فينتج لك هيدروكسيد الصوديوم !!.. فهذا مثال لما تم في التجربة لتكوين أحماض أمينية ! وهنا تتجلى المعضلة أستاذ هشام - إذا لم تنتبه - وهي : أن المشكلة في الخلية الحية ليست في وجود أحماض أمينية - لأنها تظهر عند توافر ظروف ظهورها - ولكن المشكلة هي : في تكوين بروتينات وبوليميرات !!.. فهي التي تحتاج لغائية وعاقل لاستحالتها صدفة - وباعتراف ميلر نفسه ! - وكما أوضحت لك بأرقام الاحتمالات التعجيزية : فلم ترد أستاذ هشام !!!.. >>> وأخيرا قولك متهما لي بعدم فهمي للصدفة : "" وأكرر هنا للمرة الثانية: "الصدفة تعني حدوث أو تكوّن ظاهرة ما عند توافر العوامل والظروف المناسبة والملائمة لتكوّن هذه الظاهرة" علمًا بأنَّ الركن الأساسي في هذه العملية يكون العفوية التامة غير المقصودة (غير الواعية) كمثال تكوّن الطحالب أو حتى الصدأ في الوسط الرطب. هذه هي الصدفة، "" أقول : لا يا أستاذ هشام : هذه تسمى السببية !!!.. وجيد أنك مثلت لها بظهور الطحالب أو الصدأ !!.. لأنه أينما وُجدت أسباب شيء معين : ظهر !!.. ولا دخل للعفوية ولا الصدفة هنا !!.. ويمكنك مراجعة أي معجم للغة العربية عن معنى الصدفة !!.. والآن : يمكننا تجاوز كل ما سبق لنبدأ في الحوار الجديد الذي حددته أنت .. وأعتذر عن إخلافي لوعدي بكتابة مداخلتين بدلا من واحدة .. انتهيت ..
    ---------------


    24...
    شكرا لك أستاذ هشام على أدبك وعلى ثناءك على إدارة الحوار - هي للآن مثل حكم مباراة كرة القدم الناجح الذي علامة نجاحه ألا تشعر به في الملعب - وبالنسبة لسؤالك : "" فهل أنت خَلقي Creationist أم تصميمي تتبع "نظرية" ما يُسمى بالتصميم الذكي Intelligent Design؟ "" أقول : أنا خلقي أؤمن بالخلق المباشر والمنفصل لكل كائن حي وقتما أراد الله تعالى .. ونظرية التصميم الذكي بالنسبة لي - كمسلم في الأصل - تبرهن وتظهر (((بديهيات))) ولكن : بصورة علمية لمحاججة أهل الإلحاد وإنكار الإله أو حتى إنكار (((تشخيص أو تحديد))) إله معين له علم وحكمة وإرادة وغائية إلخ .. إذا : أنا - كمسلم - آخذ من التصميم الذكي : استدلالاته (العلمية) على (بعض) بديهيات وجود خالق حكيم عليم مريد من وراء خلق الكون والمخلوقات (والحقيقة أن البديهيات الدالة على الخلق كثيرة والتصميم الذكي يتعرض لبعضها لم يزل) .. ولن تجد غالبا دليلا يذكره علماء التصميم الذكي : إلا وفي القرآن الكريم مقابله أو أصله .. مثل آيات قول الله عز وجل مثلا : " إنا كل شيء خلقناه بقدر " وأيضا قوله : "وكل شيء عنده بمقدار " .. وكذلك : " الشمس والقمر بحسبان " .. وأيضا : " والأرض مددناها وألقينا فيها رواسي وأنبتنا فيها من كل شيء موزون " .. وأخيرا وليس آخرا لعدم التطويل قوله عز وجل : "الذي أعطى كل شيء خلقه ثم هدى " .. إلى آخر الآيات .. إذا ًأستاذ هشام : أنا أؤمن بالخلق المباشر للكائنات الحية (لا أؤمن بالتطور العادي ولا الموجه) : ومؤمن بأن الله تعالى قد أحكم خلقه ليترك علامات دامغات على وجوده في آياته المشاهدة : وبما يلهث العلماء أنفسهم منذ زمان بعيد - وإلى اليوم - في مجرد تقليده أو محاكاته !!.. انتهيت ..
    ---------------


    25...
    أهلا بك أستاذ هشام من جديد .. ولنبدأ هذه الجولة (العلمية) الجديدة على خير إن شاء الله .. أنت تقول :"" من المدهش فعلًا أن يقف شخص مثقف مثلك وعلى اطلاع جيّد بالعلوم مثل هذا الموقف البراجماتي ليأخذ من العلوم ما يتوافق مع إيمانه ويرفض ما يتعارض معه "" أقول : صدقني أستاذ هشام .. العبرة في الأمور (العلمية) (التجريبية) : هي بالدليل وليس بمجرد الكلام !!!.. وفيما يتعلق بنقضي بإذن الله تعالى للتطور وتكذيبي له وفضح الغش المتعمد الذي لا ينتشر إلا به : فلن تجدني أذكر ديني فيه بكلمة واحدة -إلا إذا طلبت أنت رأي الدين في شيء معين وكما فعلت في مداخلتك السابقة - !!!.. أقول : بل ستجد كلامي كله (علميا) (واقعيا) إن شاء الله : وصدقني : لن تجدني أضع النتائج قبل المقدما أو أضع العربة أمام الحصان : ومثلما فعلت أنت للأسف باعتراضاتك على (قدرات) الله تعالى في الدين والإسلام بقولك مثلا : "" فكيف إذن تفسّر تكوّن إنسان حي "عضوي" من تمثال "غير عضوي" مصنوع من الطين اللازب؟ وهل فعلًا تم "خلق" الأنثى البشرية من ضلع الكائن البشري الأول وكأنهما كائنات وحيدة خلية، كيف يُمكنك إثبات ذلك علميًا؟ "" أقول : هنا أنت قد ارتكبت مغالطة جديدة أستاذ هشام وهي : وضع العربة أمام الحصان ! وذلك لأن ما ذكرته أنت فيما اختص الله تعالى به نفسه بالخلق : هو في الحقيقة أقل بكثير أصلا مما نؤمن به من باقي أفعال الله عز وجل !!.. وذلك لأن إيماننا بأن الله تعالى "على كل شيء قدير " : هو يسبق إيماننا بمظاهر هذه القدرة التامة التي يكفينا فيها قوله للشيء " كن فيكون " !!.. فأما عن خلق الإنسان الحي من تمثال من طين أو صلصال إلخ : فأنت هنا لم تذكر نفخ الروح !!.. وهي مما استأثر به الله تعالى لنفسه حيث يقول في سورة الإسراء : " ويسألونك عن الروح قل الروح من أمر ربي وما أوتيتم من العلم إلا قليلا " !!.. ولذلك فإن كل العلماء والملاحدة إلى اليوم - وللأبد - سيظلون عاجزين عن خلق حياة : ولو في ذبابة صغيرة !!!.. وكما تحداهم الله عز وجل في سورة الحج : " إن الذين تدعون من دون الله لن يخلقوا ذبابا ولو اجتمعوا له " !!.. فالحياة أستاذ هشام : هي مما اختص الله تعالى به نفسه .. وهي سر من أسرار الروح التي لم يطلع عليها أحد !!.. ولعلك تتذكر إحدى معجزات سيدنا عيسى عليه السلام وهي أنه كان يخلق من الطين كهيئة الطير فينفخ فيه : فيصير طيرا (بإذن الله) !!!.. بل الأعجب والأعجب : هو تحول عصا موسى عليه السلام إلى ثعبان حي : حقيقة ًوليس تخييلا ولا خداعا كما كان يفعل سحرة فرعون !!!.. وهذا ما جعل سحرة فرعون يؤمنون من فورهم بإله موسى عليه السلام لأنهم علموا أنه لا يحول الجماد إلى حياة حقيقة : إلا خالقهم وخالق كل شيء بالفعل !!.. وكذلك خلق حواء من ضلع آدم : فكيف تستغربه والعلماء استنسخوا النعجة دولي من خلية واحدة جسدية !!!.. .. وكذلك مسخ أقواما من بني إسرائيل لقردة وخنازير !!.. فالأصل في كل ذلك عند المؤمن هو (تصديقه) بأن الخبر صادر من الله تعالى القادر على كل شيء !!!.. إذا أستاذ هشام : أرجو أن ندخل في صلب دليلي الذي حاججتك به وهو (الإحكام في الخلق) : ولا داعي للتفريع لأشياء : هي من (مترتبات) الإيمان بالله تعالى المطلق القدرة أصلا !!!.. وذلك لأن الذي خلق كل هذا الكون الرهيب : ولأن الذي خلق الحياة ابتداء من لا شيء - وكما في المفهوم الديني الإسلامي - : فهو قادر بالطبع على الأقل من ذلك !!.. ومثلك هنا مثل الذي رأى رجلا قويا وقد رفع صخرة كبيرة وثقيلة جدا إلى الأعلى وبكل سهولة : فأتى له ليسأله متحديا : هل يمكن أن ترفع هاتين الزلطتين الصغيرتين ؟؟؟!!.. ولقد لفت الله تعالى عقولنا إلى هذه الحجج المنطقية في أكثر من موضع من كتابه مثل قوله في سورة غافر مثلا : " لخلق السماوات والأرض أكبر من خلق الناس ولكن أكثر الناس لا يعلمون " !!.. وقوله في سورة يس : " أوليس الذي خلق السماوات والأرض بقادر على أن يخلق مثلهم بلى وهو الخلاق العليم " !!.. وقوله كذلك في سورة الروم : " وهو الذي يبدأ الخلق ثم يعيده وهو أهون عليه " !!!.. إذا ًأستاذ هشام : مغالطة وضع العربة أمام الحصان : لا تجدي مع الهرم الإيماني للمسلم !!!.. لأن الذي يؤمن (بالدليل) بإله قادر على خلق كل شيء ولا يعجزه شيء : فلا يُوجه إليه مثل هذه الأسئلة في (فرعيات) ذلك ؟!!!.. ولكن المنطق يقتضي أن يُناقش في حقيقة وجود الخالق أولا : هل هي متحققة في الله عز وجل وظهور صفاته مثل القدرة الرهيبة والحكمة والعلم والتدبير والإرادة إلخ : أم لا ؟؟.. وذلك لأننا لم نقل لك أن إلهنا بشر مثلا : لكي تسألنا مثل هذه الأسئلة التي تمتنع على البشر !!.. وسوف أكمل الرد في المداخلة القادمة ..
    ---------------


    26...
    والآن نأتي أستاذ هشام لبعض القضايا التي أثرتها في مداخلتك .. أقول >>> بالنسبة لنظرية التصميم الذكي : أرجو ملاحظة أني لم أقل لك أن (المسلمين) يعتمدونها للتدليل على الله تعالى !!.. بل وجود الله تعالى ظاهر بالبديهيات وأبسط قواعد المنطق ..! وإنما قلت أن فيها (استدلالات) علمية مفيدة : مما يصلح معها مواجهة الملاحدة والمتنكرين للعقل والبداهة لإنكار الحكمة في الخلق وغائيته !!!.. وأما الواقع : فإن نظرية التصميم الذكي ينضم إليها (أو يناصرها ويرفعها) خليط من : الخلقيين : والقائلين بالتطور الموجه : والقائلين بخلق الكائنات الفضائية : وبعض اللادينيين !!!.. فكل أولئك : هم ضد عبثية القول بعشوائية الخلق والتطور الصدفي بلا غاية ولا عناية ولا تدبير مسبق !!!.. وما دمت تحب الاستشهاد بموقع التصميم الذكي intelligentdesign.org : فدعني أنقل لك الكلام الذي تلا مباشرة الكلام الذي اقتبسته أنت حيث قالوا في تكملته : However, the dominant theory of evolution today is neo-Darwinism, which contends that evolution is driven by natural selection acting on random mutations, an unpredictable and purposeless process that "has no discernable direction or goal, including survival of a species." (NABT Statement on Teaching Evolution). It is this specific claim made by neo-Darwinism that intelligent design theory directly challenges. والترجمة التقريبية تقول : " ومع ذلك .. فإن النظرية السائدة للتطور اليوم هي الداروينية الجديدة وهي التي تدعي أن التطور يتم عن طريق الانتقاء الطبيعي والذي يعمل على الطفرات العشوائية .. وتدعي أنه عملية لا يمكن التنبؤ بها وبلا هدف ولا اتجاه ملحوظ : بما في ذلك بقاء الأنواع . (منقول عن بيان NABT لتدريس التطور) .. ومن هذه الادعاءات المحددة التي قدمتها الداروينية الجديدة : جاء تحدي نظرية التصميم الذكي المباشر لها " ..! >>> وأما عن استخدامك لصيغة الإجماع والتعميم أستاذ هشام في قولك بكل ثقة : "" فعلماء الأحياء جميعهم يؤمنون (أو فلنقل "معترفون" حتى لا تختلط علينا الاصطلاحات) بالتطور، وأنَّ الكائنات الحيَّة (بلا استثناء) تطوّرت عبر الزمن من سلف مشترك "" فأقول لك : لا ليس كلهم !!.. فهناك الكثير منهم الذي لا يؤمن بالتطور !!.. ولا الداروينية القديمة ولا الجديدة !!!.. بل هناك من العلماء المتخصصين مَن (يسخر) صراحة ًمن التطور ويبين أخطاؤه مثل (اللاديني)ديفيد برلنسكي David Berlinski صاحب الكتاب الشهير (وهم الشيطان) The Devil's Delusion !!.. وكذلك ((الملحد)) توماس ناجيل Thomas Nagel !!.. وكذلك ((الملحد)) جيري فودور Jerry Fodor !!.. بل وهناك موقع كامل على النت : تم تخصيصه منذ عام 2001م لتسجيل أنواع معينة من المختصين بالبيولوجيا والرياضيات إلخ على توقيع اعتراضهم على التطور الدارويني الصدفي العشوائي (الطفرات والانتخاب الطبيعي) !!!.. وهو موقع dissentfromdarwin.org ..! والذي بلغ عدد المسجلين فيه على ذلك الاعتراض 828 دكتورا متخصصا بالإضافة إلى هيئات علمية كثيرة جدا : ومن كل أنحاء العالم تقريبا !!!.. وقد قمت بإحصاء هذا العدد بنفسي من الموقع وبعدد الموقعين من كل دولة (أكثرهم أمريكان) !!.. حتى أنه بات معروفا للمهتمين بأفول التطور أنه يتراجع في العديد من دول العالم مع انكشاف أكاذيبه وغشه وتدليسه يوما عن يوم !!!.. يتجلى ذلك في ظهور معاهد ومراكز وجمعيات (علمية) متخصصة في علوم (الخلق) في العالم !!!.. مثل (معهد علوم الخلق) - كاليفورنيا - أمريكا !!... و (جمعية أبحاث الخلق) - موسكو - روسيا ..! و (حركة علم الخلق) - إنجلترا !!.. وحتى في كوريا : (وحدة أبحاث الخلق) !!.. ويقول نص التوقيع على الاعتراض : We are skeptical of claims for the ability of random mutation and natural selection to account for the complexity of life. Careful examination of the evidence for Darwinian theory should be encouraged .. وبالطبع كل تلك الاعترافات تتم بصعوبة بالغة أستاذ هشام وتحت ضغط غير عادل وتهديد من جانب (التطوريين) لمنع ظهوره ونشره !!!.. ولعل من أبرز الممارسات التحجيمية لوأد هذه الاعترافات بتهافت التطور هي المضايقات الأكاديمية لأساتذة كليات وجامعات لمجرد رفضهم التطور !!!.. ولعل من أشهر التوثيقات على ذلك هو الفيلم الرائع (المطرودون : غير مسموح بالذكاء) ! Expelled: No intelligence allowed .. إذا َ.. فكلامك (المعمم) أستاذ هشام عن قبول العالم للتطور : فيه نظر !!!.. فلا العالم اليوم بالذي تنطلي عليه أكذوبة تطور أجنة هيجل ولا تدليس إنسان بلتادون ولا غش إنسان نبراسكا ! ولا العالم اليوم بالذي صار تخفى عنه الحقائق العلمية (الحقيقية) من بين ركام الإعلام التطوري والمجلات العلمية الكاذبة ! ولي مداخلة أخيرة التالية للتعليق على باقي كلامك أستاذ هشام ..
    ---------------


    27...
    انتهيت في المداخلة السابقة أستاذ هشام من التعليق على كلامك الموجه لي عن التصميم الذكي وادعاء إيمان (كل) علماء الأحياء بالتطور .. حيث بينت لك أن التصميم الذكي لم ينتهجها فقط الخلقيون : ولم توضع حكرا عليهم فقط وإنما شاركهم فيها غيرهم مثل القائلين بالتطور الموجه وغيره - لاحظ أن القائلين بالتطور الموجه لا يقدمون أي سيناريو (عملي) على هذا التطور !!.. وإنما يبرهنون فقط أنه لو وقع تطور بالفعل : للزم أن يكون بفعل فاعل حكيم مريد عليم إلخ .. وسوف أعود لهذه الجزئية إذا أثرتها معي عن التطور الموجه - أقول : وأما عن قولك : "" وربما من المفارقات الغريبة كذلك أنَّك كخلقي Creationist تؤمن بنظرية الانفجار الكبير وتدافع عنه، في الوقت الذي لا يعترف فيه الخلقيون أصلًا بهذه النظرية، ونقرأ لهم في موقعهم ما يلي: " Creationism is the theory that man, the earth, and the rest of the universe were originally created rather than randomly exploding from nothingness into chance existence" وترجمة ذلك: "علم الخَلق هو النظرية التى تناقش أن الإنسان والأرض وباقى الكون قد خلقوا فعلياً، ولم يوجدوا بالصدفة نتيجة انفجار من العدم أدى إلى وجود عشوائي"(انتهت الترجمة. المصدر creationism.org) "" وأقول أنا أبو حب الله : وهل توجه هذا الكلام لي : أم لنفسك يا أستاذ هشام ؟!!!.. عجيب !!!.. فأنا أوافق بالفعل على ما جاء فيه أنه لم يُخلق شيء صدفة : ولا انفجار من عدم >أدى إلى وجود عشوائي !!!!.. فأين الخلل هنا إذا سمحت ؟!!.. بل الكلام يؤكد ما حاورتك فيه من قبل ولا يعارضه !!!.. ولا أعرف صراحة أستاذ هشام الهدف من ذكرك لأشياء واقتباسات وآراء : هي في الحقيقة حجة عليك لا لك !!.. وأما بالعودة لمسألة الانفجار الكبير : فقد أخبرتك من قبل أنه يمكن الاستدلال علميا عليها - مع مراعاة عدم حرفية وصف الانفجار ولكن : الظهور المفاجيء - ولكنه يستحيل أن نراها كما حدثت - وهذا اعتراف العلماء أنفسهم - .. وذلك تصديقا لقول الله تعالى في سورة الكهف : " ما أشهدتهم خلق السماوات والأرض ولا خلق أنفسهم وما كنت متخذ المضلين عضدا " ..! إذا : فلا داعي - مستقبلا - لأن تلزمني بأي شيء لم ينص عليه ديني أو القرآن والسنة الصحيحة ويحدده .. فاقتباسك عن الخلقيين ورأيهم في ظهور الإنسان والأرض والكون : ظاهر في معناه المصبوب لنفي الصدفة أو العشوائية !!.. وهو بالفعل ما أقوله بل : ويعترف به علماء ملاحدة أنفسهم !!!.. >>> وأما سؤالك لي : "" فهل قام "الخالق" بخلق كل نوع بطريقة مستقلة ومباشرة، أم هنالك تفسير آخر تعزو إليه هذا التنوع؟ "" أقول : وهل أخبرك أحد أن إلهنا (الإسلامي) يا أستاذ هشام : يتعب إذا خلق 46 كائن مثلا ؟؟.. وفي نظري الخلق المباشر والمنفصل للأنواع الرئيسية : هو أكثر معقولية من القول بتطور مستحيل : لم (ولن) يستطع أصحابه إثباته إلى الآن - وإلى الأبد - لأنه - وبكل بساطة - مبني على مستحيلات عقلية !!!.. ومحض افتراضات وافتراءات وخرافات !!!.. - ومعي الأدلة التي أتركها لحينها - >>>وأما عن سؤالك : "" وحبذا لو عرفتُ موقفك من التطور كمفهوم وليس كنظرية "" أقول : عندما ضاق الأوروبيون ذرعا بالتسلط الكنسي والبابوي والكهنوتي على مجريات حياتهم وعلى العلم وقاموا بثورتهم : فقد تبلور من حينها الفكر العلماني في صورته الحديثة منذ عصر النهضة إلى القرن السابع عشر .. ذلك الفكر الذي صاغته الخطط الماسونية بهدف تسويغ عقيدة فصل الدين عن الحياة والعلوم والتي سادت بالفعل من حينها وإلى اليوم فظهرت بذلك أول تربة خصبة في العصر الحديث لغرس بذور الإلحاد وإنكار الخالق عز وجل !!!.. ولكن ...... تبقت معضلة واحدة أمامهم وهي : بماذا سيتم استبدال حقيقة وجود الخالق الصارخة في كل كائن حي ؟!.. تلك الحقيقة التي تنطق بها كل تفصيلة مُحكمة ومعجزة من تفصيلات الحياة ؟!.. فكان ماذا ؟؟.. نعم ....... هذا هو ..! بداية التقعيد العلمي - من المفترض - للتطور : والمستغني عن التدخل الإلهي في الخلق !!!.. ومن هنا أخذ داروين يجمع بذور فكرته من أفكار متهافتة مثل البقاء للأقوى لمالتوس .. والانتخاب الطبيعي ويلس .. والاستخدام وعدم الاستخدام للامارك !!!.. ومن يقرأ كتاب داروين أصل الأنواع يلمس بكل وضوح تعمده الدائم للتهرب من الاعتراف بالتدخل والضبط الإلهي للخلق : واستبداله بأي أفكار أخرى مهما بلغت تفاهتها وعدم معقوليتها باعتراف داروين نفسه !!! - انظر كلامه عن العين وتعقيدها - ! هذه هي خلاصة ((عقيدة)) التطور في نظري .. فهي ((((البديل الإلحادي)))) العلمي - من المفترض - لتفسير ظهور المخلوقات وتنوعها من غير الحاجة للاعتراف بخالق ..! وهي التي لو أعلنوا كذبها وزيفها وخطأها : لم يعد أمامهم إلا الاعتراف بهذا الخالق الذي تهربوا منه !!!.. وذلك سر استماتتهم في الدفاع عنها بكل الطرق - وكل طرقهم معتمدة على الغش والتدليس واستغلال ما لم يتم تفسيره بعد في خلع التفسيرات التطورية عليه قبل أن تظهر فائدته وإعجازه الخلقي ! - .. والآن أستاذ هشام : أنتظر منك أن تنتقي أي خيط للحوار عن الإحكام الفائق في المخلوقات أو في الخلق لنتناقش فيه .. يمكنك اختيار ما شئت : تطور - تطور موجه - مستحاثات - طفرات - جينات - تصميم ذكي - الأعضاء الضامرة - شجرة التطور - تطور الإنسان .. أو غير ذلك مما تقرره انتهيت
    ---------------


    28...
    أولا : قد أرسلت لك الإيميل الذي طلبته أستاذ هشام .. ثانيا : أنا سعيد لشعورك بالتشويق في هذا الجزء من حوارنا (العلمي) الخاص بالتطور .. حيث أحب أن نتبادل فيه المعرفة إن شاء الله ليكمل بعضنا البعض .. ولنبدأ على بركة الله >>> أنت قلت أستاذ هشام : "" في علم الفلسفة يتم تصنيف اللاأدريين على أنهم: إمَّا ماديون غير متسقون، أو مثاليون غير متسقون، ولكن حالتك هذه فريدة من نوعها، فأنتَ خلقي وتصميمي في الوقت ذاته، تأخذ من العلوم ما يتماشى مع إيمانك، وترفض، وبشدَّة، ما يتنافى معها، بصرف النظر عن موقف العلم منها "" أقول : قد أخبرتك من قبل أستاذ هشام أنك في مجال العلم (التجريبي) : لن تجدني أذكر أي شيء من ديني : إلا إذا طلبت أنت !!.. وعليه : فالساحة مفتوحة بيني وبينك لعرض الأدلة والحجج (العلمية) : وليس مجرد (الفرضيات التي لم ولن تثبت) .. >>> وأما قولك : "" وإلا فإنَّه لا يُمكن للتصميمي أن يكون لاأدريًا وهو يتحدَّث عن مُصمم ذكي"" .. أقول : بل الكثير من اللاأدريين تنحصر معضلتهم في ((تحديد)) مَن هو ذلك ((المصمم الذكي)) ؟؟.. هل هو إله مشخص ؟؟.. ولو كان : هل هو إله المسلمين أم النصارى أم اليهود أم الهندوس أم البوذيين إلخ ؟؟.. هل هو كائنات فضائية هي التي خلقتنا ؟؟.. ولو كانت : فمَن الذي خلقها بدورها ؟؟.. إلى آخر هذه الحلقة المفرغة .. إذا ً: لا مشكلة في أن تجد مؤمنا بالتصميم الذكي : وهو لا أدري .. ولكن إيمانه بالتصميم الذكي : يجعله يدري أنه لا سبيل للإيمان بالتطور الصدفي العشوائي بالانتخاب الطبيعي أو الطفرات إلخ .. >>> وأما تعليقك على موقع الرافضين للداروينية : وأن صيغة (اعتراضهم) هي تشكيكية وليست يقينية .. أقول : وهذا ما يفرضه عليهم المجتمع العلمي في الخارج .. وقد ذكرت لك أمثلة عما يواجهه الأساتذة والدكاترة الذين يرفضون التطور العشوائي في الخارج من الطرد من العمل أو المضايقات الأخرى .. وأما قولك : "" (1) أنهم لا يرفضون التطوّر، وإنما يتشككون حول آليتها فقط "" أقول : التشكيك في الشيء = عدم اليقين منه !!!.. فنحن في الإسلام مثلا يمكن أن تقع للمسلم شبهات .. ولكنه الذي يتشكك في وجود الله تعالى فهذا كفر والعياذ بالله يحتاج إلى حوار وعلاج .. فالأول مع وسوسته أو شبهاته : مسلم .. وأما الآخر الذي تشكك في وجود الله : فكافر !!.. لأن الإيمان مبني على اليقين وليس الشك .. إذا ً: تشكيك العلماء هنا هو بمعنى رفض اليقين الذي ((تدعيه)) الأوساط العلمية في الخارج وتنشره ((بكل ثقة)) على أنه أمر مسلم به لخداع العوام والبسطاء : وهو ليس كذلك بتاتا ً!!!!.. وأما عن قولك : "" (2) أنهم لا ينكرون وجود طفرات عشوائية والانتخاب الطبيعي "" أقول : وأنا كذلك لا أشكك في وجود طفرات ((((عشوائية)))) ولا انتخاب طبيعي ((((عادي)))) لأفراد الجنس (((الواحد))) حسب ظروفهم المحيطة بهم .. ولكن التشكيك ((بل الرفض التام)) هو ادعاء أن الطفرات العشوائية أو الانتخاب الطبيعي : قادران على ((((خلق)))) عضو واحد زائد أو جديد بالكلية عن الكائن الحي !!!!.. وهذا ما سأثبته بإذن الله تعالى أستاذ هشام : بـ (الدليل) و (العلم) : وليس ببراجماتية الدين : تلك التهمة (الجاهزة) التي يلقيها الملحد في وجه الخلقي المعارض للتطور : سواء قبل الحوار - كما فعلت أنت - أو في أثنائه - وكما فعلت أنت أيضا - أو بعد فشل الرد عليه - وكما سيحدث إن شاء الله - .. >>> وقبل البدء في الدخول في التفاصيل العلمية أستاذ هشام لنقد ما تفضلت بقوله عن التطور وآلياته .. فلي تعليق أخير على قولك : "" وعمومًا وقبل أن أدخل مباشرةً في الموضوع أحب أن أشير إلى أعجوبة من أعاجيب نقاشي "العلمي" معك، وهي أنك تنزع دائمًا إلى طرح أسئلة ليست علمية أصلًا، مثل: "من أو ما الذي ضغط القوى الأساسية؟" وكذلك: "من الذي هدى أو ألهم الخلية أن تفعل ذلك؟" وأنتَ أعلم مني يا عزيزي بأنًّ العلم لا يناقش هذه الأسئلة ولا يأخذها في حسبانه، بل هو يبحث دائمًا حول: "كيف حدث ذلك؟" أو "لماذا حدث ذلك؟ "" أقول : تساؤلك في محله أستاذ هشام في التفريق بين "مَن الذي ضغط أو ألهم" وبين "كيف أو لماذا حدث ذلك" ! والسبب بسيط وهو أنه عندك - كملحد - : يستوي أن يظهر الكون في لحظة معينة من الوجود - لا غيرها - بغير سبب !!.. ويستوي أن تظهر عندك علامات التسيير والنظام في ذرات وجزيئات لا تعقل بمسبب عاقل أو بغير سبب !!!.. حيث تخيل أن المادة التي لا عقل ولا حرية اختيار لها : (((قررت))) أن تظهر للوجود في لحظة معينة - وذلك منذ 15 مليار سنة مثلا هي عمر الكون - : وليس قبلها وليس بعدها ..! فأي عاقل يقول : إما أن المادة بالفعل وكما قلت (((قررت))) !!!.. وإما أن هناك مَن دفعها للظهور والميلاد في هذه اللحظة ((الفريدة)) من الوجود تحديدا !!!!.. وحتى لو كانت ذبذبة كمومية في الوجود (ولا أعرف صراحة كيف تكون ذبذبة في اللافضاء) ولكن حتى مع هذا الفرض : فمَن الذي ذبذبها أو دفعها للتذبذب ؟!!.. ومهما يضع الملحد من تبريرات و(مسببات) : فسيظل كل سبب منها يحتاج إلى مسبب بداهة !!!.. وليس له من خروج إلا بالاعتراف بخالق أزلي : وليس المادة نفسها التي يُذبذبها ((شيء ما)) !.. وعلى العموم .. لا تشغل بالك بمثل هذه الأمور كثيراى أستاذ هشام .. فلا أنت نجحت في تفسير منطقي لأزلية المادة : ولا نجحت في تفسير منطقي للإعجاز في تصرفات الذرات والجزيئات في بروتينات الخلية الحية والحمض النووي .. وربما تعرضت لتلك الإعجازات قريبا معك .. والآن .. أنتقل للمداخلة الثانية ..
    ---------------


    29...
    أما قولك أستاذ هشام : "" التطوّر ببساطة شديدة هو: "اكتساب الكائن لصفة جديدة لم تكن موجودة في سلفه تساعده على البقاء" وهي على هذا النحو لا تعني التعقيد بالضرورة "" أقول : هذا الكلام ليس علميا بالمرة !!!.. لأنك هنا لم تحدد هذه الصفات وكيفية ظهورها بـ (غائية) مسبقة !!.. مثل جناح الطيور مثلا !!!!.. فجناح الطيور التي تطير - وفضلا عن أجسامها - هو فريد في تكوينه بطريقة تطابق وظيفة الطيران !!.. ولا يتخيل كائنا من كان أنه ظهر بالتدريج ((العشوائي)) : اللهم إلا الذي لا يعرف شيئا عن تكوين الأجنحة والريش في الطيور البتة !!!.. بدءا من التكوين الفريد لعظامها لتكتسب قوة وصلابة ولكن مع خفة !!!.. أو مع تكامل نظام التغذية الدموية للريش والجناحين لمدهما بالطاقة !!!.. أو مرونة العضلات التي لا تحترق مع كثرة الرفرفة !!.. وانتهاء بالتصميم الديناميكي الهوائي المبدع للريش وتفرعاته إلخ إلخ إلخ .. والشاهد : أنه من العبث القول بأن التطور لا يعني التعقيد بالضرورة !!!.. بل هذا تهرب وعجز تفسير التعقيد في الكائنات الحية !!!.. ومن العبث أيضا القول بأن التطور هو ظهور صفة جديدة - هكذا بكل بساطة وسطحية - : وذلك لأن العضو الواحد ((الجديد)) لكي يظهر في الكائن الحي : يجب أن يظهر كاملا مرة واحدة وبمستلزماته من جهاز عظمي ودوري وعضلات وأعصاب وهدف جديد في البيئة : وإلا لو ظهر على مراحل (جدلا) عن طريق الطفرات : فهو في كل مرحلة هو بلا الفائدة : ولأنه لم يكتمل بعد !!.. ولكان بهذا قد تخلص منه الانتخاب الطبيعي (نفسه) عندكم : لأنه يتخلص من كل ما هو ضار وغير نافع مما يظهر على الكائنات الحية من طفرات !!!!.. إذا ً: القول بالتطور بالطفرات المتدرجة : ينسفه مفهوم الانتخاب الطبيعي المزعوم نفسه !!!.. اللهم إلا تحليتم بـ (الانتقائية) وقلتم أن الانتخاب الطبيعي : تارة يتخلص من الطفرات الغير مفيدة (وإلا لكنا رأينا اليوم ملايين المخلوقات المشوهة بعدد الطفرات التي تفترضونها بعشوائيتكم) : في حين تارة أخرى يترك بعض الطفرات والتي - ويا للمصادفة المبهرة - تكون هي المفيدة على المدى البعيد الذي لا يعرفه أحد ولا يعرف له غاية مسبقة بعد (مثل ظهور جناح للطيران) !!!!.. >>> وأما عن قولك أستاذ هشام : "" والانتخاب الطبيعي ملازم تمامًا لعملية التطوّر؛ فالكائنات التي تملك صفات تؤهلها للبقاء تبقى (هذا هو الانتخاب الطبيعي بكل بساطة) والنظرية أدهشت العلماء حقًا لفرط بساطتها "" أقول : بل هي أدهشت العلماء العقلاء : من فرط سذاجتها !!!.. وذلك لأنها خلعت على الطبيعة التي لا تعقل : صفات الانتقاء!!!!.. وذلك محال باتفاق العقلاء : إلا أن يكون التطور هو (أيدلوجية) يتشبث المؤمن بها فقط حتى لا (يضطر) للاعتراف بوجود خالق !!!.. وهذا ما سأنقله بعد قليل بالفعل من اعترافات وتصريحات !!.. ولكن قبل ذلك : تعالى نستعرض معا هلهلة فرضية الانتخاب الطبيعي .. أقول : سنأخذ مثالا على هذا وهو : التصميمات البديعة من أشكال وألوان في أجنحة الفراشات .. والسؤال هو : كيف ولماذا ومَن ؟؟؟ (كيف) ظهرت نتيجة العشوائية ؟!!.. و(لماذا) ظهرت أصلا ًبجمالها الخلاب الذي لا تدركه طبيعة صماء فضلا عن أن تكون قد صممته !!.. و(مَن) الذي اختار أن يكون هناك فراشات بأجنحة خلابة الأشكال والألوان : أو أن تكون بغير زخرفة أصلا : أو بأشكال قبيحة !!.. مَن ذلك الذي (استشعر) الجمال وقرر واختار واستبعد أو أبقى ؟!!!.. هل هو الانتخاب (الطبيعي) ؟؟.. ذلك الكيان الهلامي الذي لا وجود مادي له في الحقيقة ؟!!.. إذا ً.. الانتخاب (أو الانتقاء) الطبيعي له معضلتين وهما : أنه لا يستطيع تفسير ((كيفية)) ظهور التركيبات والأعضاء والصفات الأساسية ((الجديدة)) في الكائنات الحية مع الزمن -ومن هنا جاء الاعتماد على الطفرات في الداروينية الجديدة - والمعضلة الثانية هي أنه لا يستطيع أن يفسر لنا الانتقائية في الاستبعاد او الإبقاء : والتي تتطلب (عقلا واعيا مختارا له وعي وحرية اختيار وإرادة) !!.. وهذا مزلق من المزالق التي (ابتدعها) داروين في كتابه أصل الأنواع وسخر منها العقلاء !!!.. ذلك أنه استخدم في وصفه للانتخاب الطبيعي : نفس صفات ما يحدث من الانتخاب الصناعي (أي بفعل الإنسان) عند التهجين !!.. حيث ينظر المزارع مثلا لصفات الأبقار أو الأرانب أو الداجن عموما : ليمايز بين صفات الأنواع .. ثم يقيم .. ثم يقرر التخليط والتهجين بين أفضلها أو ما يعطيه النتائج التي يرد (داخل النوع الواحد وليس خارجه) : ثم يقوم بالتهجين ..! فأتى داروين وبعد أن تحدث عن كل هذه الآليات في كتابه : فخلعها على الانتخاب الطبيعي بكل سذاجة وسطحية !!!.. ينتقد ذلك العالم التطوري ستيفن جولد نفسه Stephen Gould : معتبرا إياها خللا في آلية الانتخاب الطبيعي ((المفترض)) فيقول تعليقا عليها في كتاب داروين : The principle of natural selection depends upon the validity of an analogy with artificial selection المصدر - Stephen Gould - Ever Since Darwin p 41 .. وأما عن حقيقة نظرة العلماء والعقلاء لـ (عقيدة) التطور المتهالكة أمام هذه الآليات التي لا تثبت وتفسير تمسكهم بالتطور رغم ذلك : فأوضحه في مداخلتي القادمة ...
    ---------------


    30...
    لا شك أن فرضية التطور كما أظهرها وقعد لها داروين ومنذ أول ظهورها : وقد عرف العقلاء أنها ما هي إلا (محاولة عقيمة لاستبدال الخالق عز وجل وتبرير الإلحاد) !.. وذلك لتهافت فرضياتها والأسس التي أقامها داروين عليها : والتي اعترف هو في كتابه - في عشرات المواضع لمَن قرأ الكتاب بالفعل - بمعضلاتها التي لم يعرف داروين حلا لها في وقته : فأوكلها للمستقبل كمحاولة للهروب ولكن : الرياح أتت التطوريين بما لا تشتهيه الأنفس !!.. فلم تثبت - وإلى اليوم - أية فرضية للتطور ولم يرى البشر مثالا واحدا لتطور كائن من كائن أو حتى ظهور عضو جديد ولا حتى شاهدوا أيا من الطفرات (المعجزة) التي يتخيلها التطوريون !!.. بل وكلما زاد العلم في اكتشاف التعقيد والغائية في كل كائن حي على حدة : تهدمت فكرة التطور والتسلسل العشوائي والصدفي من الأساس !!.. فقد اعتمد داروين في تفسيره أولا على خرافة انتقال الصفات المكتسبة وتوريثها إلى النسل !!.. وأما الانتخاب الطبيعي : فرغم صحة فكرته في تأثر الكائن الحي بالفعل بالبيئة من حوله من غذاء وافتراس وتغير مناخ إلخ .. إلا أن ذلك كله لا علاقة له البتة في ظهور (عضو جديد واحد ليس من جسد الكائن الحي) : لا بتفسير كيف : ولا لماذا : ولا مَن الذي انتقى واختار واستبعد وأبقى !!.. وكذلك الطفرات - وكما سنرى في المداخلة البعد القادمة- فهي أفشل من أن يُنسب إليها إظهار عضو (جديد) في الكائن الحي !!.. بل هي في معظمها ضارة في الأصل .. بالضبط كمَن يمسك بجهاز تلفاز ثم يهزه عشوائيا : فهل أي تغيير بداخل الجهاز من جراء هذا الهز : سيكون مفيدا ؟!!.. هذا الكلام لا يقوله إلا غشاش لنفسه وللعلم .. ولا يصدقه إلا مَن لا يعرف مدى التعقيد والدقة والنظام الذي عليه الخلية الحية والحمض النووي الوراثي وجيناته وشيفراته ..!! أيضا مشكلة ((انعدام)) العثور على الحفريات للكائنات الوسطية - المفترضة - في التطور : والتي لم يتم حلها إلى اليوم ! ورغم وصول اكتشاف حفريات لكائنات حية لأكثر من 450 مليون سنة مضت - أي بدائيات بدائيات الحياة والخلية الأولى - !!.. وهذا هو السبب الحقيقي للجوء علماء التطور والمؤمنون به إلى (((عشرااااااااات))) الاكاذيب والغش والخداع والتدليس في ((اختراع)) حلقات وسطية : لبشر أو أسماك أو طيور إلخ : ثم يفضحهم العلم في كل مرة ولكن : لا يتعظ أحد من المخدوعين بهم !!.. وذلك لانها (أيدلوجية) كفر وإلحاد : وليست علما له شواهد وأدلة حقيقية !!.. - وقد اعترف فرانسيز داروين Francis Darwin - ابن داروين - بالتردي الديني الذي وصل إليه داروين في النهاية بسبب نظريته وذلك في نشره لمذكرات أبيه بعد موته ورسائله بخط يده بعنوان The Life and Letters of Charles Darwin .. ومعلوم أن داروين كان متشككا دينيا منذ شبابه وقراءته لمالتوث .. وكذلك سجلت هذه الحقائق المؤرخة الداروينية جيرتريود هيميل فارب Gertrude Himmerfarb عن التردي الديني لداروين وإنكاره الخالق وباعتراف زوجته إيما Emma وذلك في كتاب داروين والثورة الداروينية Darwin and the Darwinian - !!..
    ---------------


    31...
    >>> ولذلك كله يلخص لنا هذه الحقائق والاعتراضات التطوري آرثر كيث arthur keith باعترافه في كتابه المثير الدين والعلم religion and science فيقول : " إن نظرية النشوء والارتقاء : غير ثابتة علمية !!.. ولا سبيل لاثباتها بالبرهان !!.. ونحن لا نؤمن بها إلا : لأن الخيار الوحيد بعد ذلك هو : الايمان بالخلق الخاص المباشر " !!!.. وأفسح للنقولات التالية أيضا - وعندي النصوص الإنجليزية لها لمَن يريد - حيث يقول مايكل روز : " التطور : هو بديل كامل للمسيحية ..! التطور دين ..! هذه حقيقة التطور منذ البداية : وهي حقيقة التطور حتى اليوم " !!.. المصدر - انقاذ الداروينية من الداروينيين . الناشونال بوست مايو 13 – 2000م .. ويقول إتش . اس . ليبسون في كتابه (نظرة فيزيائية إلى التطور) : " في الحقيقة .. وتبعاً لنشر كتاب داروين أصل الأنواع : أصبحت نظرية التطور وبشكل ما : دينا علميا ..! كل العلماء تقريبا قبلوها .. والعديد منهم أصبحوا مستعدين للوي أعناق العينات والملاحظات لتتوافق معها " !!.. وفي نفس المعنى تعترف مجلة العلوم الأمريكية في عدد كانون الثاني (أي يناير) 1965م بقولها وبكل صراحة : " إن جميع علماء التطور : لا يتورعون عن اللجوء إلى أي شيء : لإثبات ما ليس لديهم عليه من دليل " !!.. ويقول بول ليموينالموسوعة الفرنسية – وهو رئيس المجمع الجيولوجي في فرنسا ورئيس متحف التاريخ الطبيعي في باريس : " نظرية التطور مستحيلة ..! ففي الأساس : وعلى الرغم من المظاهر : لم يعد أحد يؤمن بها ...! إن التطور نوع من الدوجما : حيث وعاظها لم يعودوا يؤمنوا بها !!.. ولكن لكي يبقوا على أتباعهم " !!.. وكمثال حي على هذه الدوجما : يقول لاري مارتن - اختصاصي الطيور القديمة بجامعة كنساس - : " لأصدُقَك القول .. إذا اضطررت إلى تأييد الفكرة القائلة بأن أصل الطيور هو الديناصورات بصفاتها الحالية : فسأشعر بالخجل في كل مرة أضطر فيها للنهوض والتحدث عن هذا الموضوع " !!.. المصدر - بات شيبمان - كتاب (الطيور فعلتها : فهل فعلتها الديناصورات ؟) .. ويقول كينث جاي. سو في كتاب (الصخور الرسوبية والتطور البيولوجي) : " كلنا سمعنا عن أصل الأنواع .. وبالرغم من أن القليل منا وجد وقتا لقراءته .. فإن مطالعة عارضة للنسخة الكلاسيكية : جعلتني أتفهم غضب باول فيرابند !!.. أتفق معه أن الدراوينية تحتوي "كذبات خبيثة" ..! إنها ليست قانونا طبيعيا صيغ على أساس دليل حقيقي !.. بل هي دوجما : تعكس هيمنة الفلسفة الاجتماعية في القرن الماضي " !!.. ويقول السير ويليام داوسون في كتاب (قصة الأرض والبشر) : " هذا المذهب التطوري : هو بحد ذاته من أغرب الظواهر عند البشرية !!.. إنه نظام خالي من أي إثبات !!.. ومدعوم بالتشبيهات الغامضة ورموز الخطابة !!.. الآن لا أحد يدعي أنهم يعتمدون على حقائق مشاهدة واقعيا !!.. لأنه لم يوجد أحد لاحظ انتاج ولا نوع واحد " !!.. ونتيجة لهذه الدوجما الرهيبة : والتي تسببت في الخلط (المتعمد) من علماء التطور للتغير الجيني الطبيعي سواء بالتهجين وغيره وبين التطور الخرافي الذي يتخيلونه : فسموا الأول المعترف به في الأحياء بالفعل والبيولوجيا الجزيئية بالتطور الأصغر MicroEvolution - لكي يوحي بأنه مؤدي حتما للتطور الأكبر - وسموا تطورهم الخرافي التخيلي بالتطور الأكبر MacroEvolution : فادعوا بذلك أن التطور هو أساسي في كل العلوم الأحيائية (العملية) والبيوكيميائية اليوم - والمفروض أنهم يقصدون التطور الأصغر لا الأكبر - أقول : نتيجة لذلك يخبرنا مثلا كولين باتيرسون - مدير الحفريات بالمتحف البريطاني للتاريخ الطبيعي قائلا : " علم الأحياء ما بعد الدارويني : وضعه أناس يعتقدون بالغالب بقدسية داروين " !!.. ويقول كولين باتيرسون أيضا في كتابه عن التطور : " لقد حذر كارل بوبر من أحد الأخطار قائلا : إن أي نظرية : حتى ولو كانت نظرية علمية : قد تكون موضة ثقافية !!.. وبديلة عن الدين !.. ودوجما مترسخة !!.. وهذا ما ينطبق بالفعل على النظرية التطورية " !.. ويقول تي . راسوزاك في كتابه (الحيوان الغير مكتمل) : " ياللسخرية ..! كان الهدف الرئيسي من الداروينية : إزالة آخر أثر للإله العظيم في الأحياء .. ولكن النظرية استبدلته بإله أكبر ألوهية منه : الصدفة المطلقة " !!!.. ويقول إي هاريسون في كتاب (أصل وتطور الكون) : " التطور : هو العنصر الأسطوري الرئيسي في فلسفةٍ : تـوظـف كدين واقعي " !!.. ويقول جي.اي.كيركوت في كتاب (آثار التطور) : " وهكذا تكون المسألة مسألة إيمان عند البيولوجي !!.. مسألة أن النشوء الحيوي : قد حدث .. ثم هو يختار ما يشاء من طرق تناسبه شخصيا لاقتراح كيف حدث هذا النشوء !!.. بينما الدليل على حدوثه فعليا : ليس متوفرا " !!.. وأخيرا يقولاس.جاكي في كتاب (الأكوان والخالق) : " الداروينية عقيدة : ليست فقط عند العلماء الذين قاموا بتوثيق قانون الانتخاب الطبيعي لكل شيء : إنها عقيدة لكثير من الناس الذين لديهم في أفضل أحوالهم فكرة غامضة ومشتبهة لميكانيزم التطور كما قدمها داروين !!.. والتي تعقدت أكثر عند اتباعه و مريديه " !!.. وأؤجل المداخلة القادمة عن الطفرات لما بعد صلاة الجمعة إن شاء الله ..
    ---------------


    32...
    أبدأ هذه المداخلة بمقولة شهيرة لعالم البيولوجيا الجزيئية مايكل بيهي إذ يقول : " الدارونية الحديثة فسرت التطور الدقيق microevolution بشكل رائع .. لكن عند الحديث عن التطور الكبير macroevolution فعلى التطوريون أن يصمتوا " !!.. أقول : وهذه العبارة منه تلخص كل شيء لمَن يفهم !!!.. وتلخص حقيقة وجود ((حوض جيني Gene Pool)) يحيط بكل نوع من الكائنات الحية : لا يتخطاه النوع إلى غيره أبدا ومهما فعلنا !!!.. فإذا أخذنا مسألة الطفرات : وجدنا ترجمة عملية للخلط (المتعمد) والمشين من جهة التطوريين بين الحقائق !!.. وذلك في استغلال منهم لجهل العوام والبسطاء بالطفرات وحقيقتها وآلياتها !!.. حيث - وإلى اليوم - ما زال يظن الكثير من العوام والبسطاء أن الطفرات : هي قفزة (سحرية) لإكساب الكائن الحي صفة (زائدة) عن جسده أو عضوا (جديدا) : لم يكن موجودا من قبل !!.. وأن هذه الصفة أو هذا العضو الجديد : يكون مفيدا !!!.. أقول : الطفرات هي أخطاء في نسخ الحمض الوراثي أثناء التضاعف !!.. وكونها أخطاء : فهو لا ينتج عنها شيئا مفيدا بالمرة - وهذا من المفترض أن يُعلم بداهة !! - : وذلك لأن الحمض الوراثي لكل كائن حي : هو غاية في الدقة أصلا والتخصص والنظام !!.. الأمر أشبه بقالب - أو اصطمبة - حروف لكتاب .. فليس مستحيلا أن يقع خطأ في طباعة حرف أو تكراره بسبب زيادة الحبر أو ضعف الماكينة إلخ وذلك في بعض العبارات من الكتاب - كل عبارة تمثل صفة وراثية مثلا - .. ولكن المستحيل - كل المستحيل - هو أن نسمع عن خطأ في ماكينة قالب حروف الكتاب : ينتج عنها ((جملة)) ((جديدة)) ((تماما)) و((لها)) ((معنى)) !!!.. ولذلك نجد العالم رانغانثان يقول : " إن الطفرات : صغيرة وعشوائية وضارة !!.. وهي تتسم بندرة حدوثها - أقول أنا أبو حب الله : لأنه حتى مع وقوع أخطاء في النسخ : فيتم تصحيح معظمها بآلية معجزة داخل الخلية يستحيل أن تكون وليدة العشوائية أو الصدفة أبدا ..! ويواصل رانغانثان قوله : - وفي أفضل الاحتمالات يمكن أن نقول أن الطفرات : غير مؤثرة ..! وتشير هذه السمات الأربع إلى أن الطفرات : لا يمكن أن تؤدي إلى أي تقدم على صعيد التطور !!.. وذلك لأن حدوث تغير عشوائي في كائن حي يتسم بقدر عال من التخصص : فإما أن يكون غير مؤثر : وإما أن يكون ضاراً !!.. ذلك أن التغير العشوائي في ساعة اليد : لا يمكن أن يحسن أداء الساعة !!.. بل أغلب الظن أن هذا التغير سيضرّ بها : أو لن يؤثر فيها على أحسن تقدير ..! والزلزال : لا يُحسن المدينة !!!.. بل يجلب لها الدمار " !!.. المصدر - B. G. Ranganathan, Origins?, Pennsylvania: The Banner Of Truth Trust, 1988 .. أقول .. ورغم أن لدي ((عشرات)) الاعترافات والتصريحات من العلماء المختصين بتهافت تعلق التطور بالطفرات .. إلا أني لن أذكرها إلا إذا طلب مني الأستاذ هشام ذلك حتى لا أطيل في المداخلات .. ولكني سأجعل حديثي أقرب تحديدا بأمثلة - وهو ما أتمناه من الأستاذ هشام في المستقبل : أن يعطينا مثلا عمليا عن التطور بآلياته التي يؤمن بها : وليكن مثال تطور وظهور الأجنحة مثلا ! - أقول: فكل الأمراض التشوهية في الأجنة والمتلازمات الجنسية - مثل متلازمة كلاينفلتر إلخ - هي عبارة عن أمثلة للأخطاء في النسخ أو التضاعف والتي لم يتم تداركها !!!.. وحتى ذبابة الفاكهة التي عكف عليها التطوريون لإحداث مئات الطفرات بها - واختاروها خصيصا لصغر عمر الجيل الواحد منها الذي تظهر عليه نتائج الآباء والأبناء والذي هو أقل من أسبوعين فقط - : فقد باءت محاولاتهم كلها بالفشل الذريع !!!.. يقول عالم الوراثة التطوري غوردون تايلور : " من بين آلاف التجارب الرامية إلى إنتاج ذباب الفاكهة التي تم إجراؤها في جميع أنحاء العالم لأكثر من خمسين سنة : لم يلاحظ أحدٌ أبداً ظهور نوع جديد متميز !!.. أو حتى إنزيم جديد " !!.. المصدر - Gordon R. Taylor, The Great Evolution Mystery, New York: Harper & Row, 1983, p. 48 .. وبطريقة أكثر تفصيلا يقول مايكل بيتمان : " لقد قام مورغان وغولدشميدت ومولر وغيرهم من علماء الوراثة : بتعريض أجيال من ذباب الفاكهة لظروف قاسية من : الحرارة والبرودة والإضاءة والظلام والمعالجة بالمواد الكيماوية والإشعاع ..! فنتج عن ذلك كله جميع أنواع الطفرات .. ولكنها كانت كلها تقريباً : تافهة أو مؤكدة الضرر ..! فهل هذا هو التطور الذي صنعه الإنسان ؟!!.. في الواقع لا .. لأنه لا يوجد غير عدد قليل من الوحوش التي صنعها علماء الوراثة : كان بإمكانه أن يصمد خارج القوارير التي أنتج فيها ..! وفي الواقع : فإن هذه الطافرات إما أن يكون مصيرها الموت : أو العقم : أو العودة إلى طبيعتها الأصلية " !!.. المصدر -Michael Pitman, Adam and Evolution, London: River Publishing, 1984, p. 70 .. أقول : فمسألة الطفرات : ليست بالسطحية ولا البساطة التي يصورها التطوريون لأتباعهم غشا وتدليسا !!!.. فهناك موانع كثيرة جدا تقف في وجه اعتماد الطفرات (العشوائية) كشيء نافع أصلا : فضلا عن أن تكون سببا للتطور !!.. وكلما تطور العلم البيولوجي والتجريبي : اكتشف معضلات كثيرة كل يوم تدفن خرافات التطور أكثر وأكثر !!.. وسوف أتعرض لهذه المعضلات باختصار : ومعها الحديث عن مثال مقاومة البكتيريا لبعض أنواع المضادات الحيوية في المداخلة الأخيرة التالية إن شاء الله ...
    ---------------


    33...
    1- معضلة التصحيح الذكي DNA repair لأخطاء النسخ والتضاعف في الحمض الوراثي !!!.. 2- والمعضلة الثانية - وهي متعلقة بالمعضلة الأولى - وهي أشد تعقيدا لأنها أثبتت أن الكفاءة التفارقية في عمل نظام التصحيح القرائي للشريط الوراثي Proofreading : تزيد أصلا في المناطق المهمة من الشريط الوراثي (أي الحاملة للصفات الوراثية) : وتقل في القطع الغير حاملة للصفات الوراثية (كالإنترونات) !!!.. وكلما زادت احتمالية التطفر : زادت قدرتها على التصحيح !! المصدر - Freeman & Herron 2001 وبذلك يظهر تهافت أكاذيب التطوريين على الطفرات من الأساس !!..3- وفي نفس سياق المعضلة السابقة نجد أن معظم جينات الصفات على الحمض النووي : تقع في مناطق معينة على سلاسل الـ DNA الطويلة تسمى جزر isochores .. وهذه الجزر تتكون أساسا من العلاقةG-C من قواعد الحمض النووي الأربعة (وهي تتكون من ثلاث روابط هيدروجينية مقابل رابطتين فقط في العلاقة A-T) ولذلك فقد وجد العلماء أن هذه الروابط الـ G-C : هي الأكثر تماسكا ًفي الحمض النووي (وعلى أساسها يتم قياس درجة تحمله للتفكك الحراري) !.. وبمعنى آخر .. فإن نسبة GC ratio of genomes : تقف عائقا أمام تخيل الباب مفتوحا أمام الطفرات لتحدث بسهولة في منطقة جينات صفات الكائن الحي وتضر بها !!!.. وهنا نأتي لسؤال هام وهو : وماذا عن المثال اليتيم الذي يكرره التطوريون والملاحدة دوما للتمثيل على الطفرات المفيدة وهو مقاومة بعض أنواع البكتريا للمضادات الحيوية ؟؟.. أقول .. قبل أن أعرض المعلومات المذهلة التالية والتي يتم إخفاءها (عمدا للأسف) من جهة التطوريين والملاحدة (الأكابر) : فأحب أن أشرح ببساطة فكرة ظهور مقاومة بعض أنواع البكتيريا لبعض المضادات الحيوية .. أقول : الفكرة هنا هي في وجود آليات بالفعل داخل البكتيريا لمقاومة التأثر بالمضادات الحيوية !!.. وكل ما يتم هو ربما استبدال نيكلوتيدة واحدة فقط فينتج عنها الإنهاء على ريبوسوم الخلية البكتيرية والذي يتمسك به المضاد الحيوي (مثل الستربتومايسين Streptomycin مثلا) أي أننا ما زلنا داخل (نفس) الحمض النووي ولم يزد عليه شيئا كما يدعي التطوريون والملاحدة !!.. وفي ذلك السياق نجد مجلة المعرفة الأمريكية Scientific Americanوفي عدد آذار (مارس) 1998م : تعترف (ورغم أنها من المجلات المروجة للتطور) فتقول : " كثير من البكتيريا كانت لديها معلومات وراثية للمقاومة : قبل استخدام المضادات الحيوية التجارية !!.. ولا يعرف العلماء سبب وجود هذه المعلومات الوراثية !!.. كما لا يعرفون لماذا تم الحفاظ عليها وإبقاؤها " !!.. المصدر - Stuart B. Levy, "The Challange of Antibiotic Resistance", Scientific American, March 1998, p. 35 .. أقول : ولعل ذلك يفسر لنا العدد الكبير من المعلومات التي ما زال يجهل العلماء ترجمتها على الشريط الوراثي وتظهر فائدتها كل يوم وهم الذين كانوا يصفونها بـ (الجانك جين) !!.. وهذه مجلة Medical Tribune المرموقة علميا تقول أيضا وبكل وضوح في عددها 29 كانون الأول (ديسمبر) 1988م : " في دراسة أُجريت عام 1986 : تم العثور على جثث بعض البحّارة الذين أصابهم المرض وماتوا أثناء رحلة قطبية استكشافية عام 1845 : محفوظة في حالة تجمد .. كما عُثر في أجسامهم على نوع من البكتيريا : كان منتشراً في القرن التاسع عشر .. وعندما أُجريت على هذه البكتيريا فحوص معملية : وُجِد أنها تحمل خواص مقاومة ضد كثير من المضادات الحيوية التي لم يتم إنتاجها إلا في القرن العشرين " !!.. المصدر - Medical Tribune, December 29, 1988, pp. 1, 23 .. أقول : وهذا الاعتراف - ومثل سابقه - يهدم أكذوبة أن هذه المقاومة (لم تظهر) إلا (بعد) اختراع تلك المضادات الحيوية في القرن العشرين !!!.. بل كانت موجودة من قبلها ولا تطور ولا يحزنون !!!.. والأمر مشابه كذلك في الحشرات ومقاومتها للـ DDT وغيره .. حيث يقول عالِم الأحياء فرانسيسكو أيالا (وهو أيضا من دعاة التطور) : " يبدو أن التنوعات الوراثية المطلوبة لاكتساب المناعة ضد أكثر أنواع المبيدات الحشرية : كانت موجودة لدى جميع الحشرات التي تعرضت للمركبات الكيميائية التي صنعها الإنسان ضد الحشرات " !!.. المصدر - Francisco J. Ayala, "The Mechanisms of Evolution", Scientific American, Vol 239, September 1978, p. 64 .. وبالعودة لتفصيل ما يحدث عند ظهور مقاومة البكتيريا : فيشرح لنا الأستاذ لي سبتنر إحدى آليات مقاومة البكتيريا في مقالة له نشرت في سنة 2001 م فيقول : " لقد وُهبت بعض الكائنات المجهرية جينات : تقاوم هذه المضادات الحيوية !!.. ويمكن أن تتجسد هذه المقاومة في حل جزيء المضاد الحيوي : أو طرده من الخلية !! وبإمكان الكائنات المالكة لهذه الجينات أن تنقلها إلى بكتيريا أخرى : وتجعلها مقاوِمة أيضا !!.. وعلى الرغم من أن آليات المقاومة تتخصص في مقاومة مضاد حيوي بعينه : فإن معظم البكتيريا المسببة للأمراض قد نجحت في تجميع مجموعات متعددة من الجينات : مما أكسبها مقاومة ضد تشكيلة متنوعة من المضادات الحيوية " !!.. المصدر Dr. Lee Spetner, “Lee Spetner/Edward Max Dialogue: Continuing an exchange with Dr. Edward E. Max,” 2001 .. والخلاصة التي خرج بها العلماء المتخصصون أستاذ هشام هي أن مقاومة البكتيريا تعتمد على آليتين : لا علاقة لهما بمفاهيم التطور وطفراته لا من قريب ولا من بعيد وهما : 1- نقل جينات المقاومة الموجودة فعليا في البكتيريا .. 2- بناء مقاومة نتيجة لفقدان بيانات وراثية بسبب الطفرة .. انتهيت ..
    التعديل الأخير تم 03-11-2013 الساعة 05:32 PM

  7. #7

    افتراضي

    لحظة واحدة، ما المشكلة في الـ"micro-evolution"؟ كما ان الطفرات تستطيع ازال عضو كامل، مثلاً بسبب التسرب الاشعاعي في اليابان ولدت ارانب بتشوهات، مثل عدم وجود آذان، سؤال آخر: هل انت يا أخي أبوحب الله قرأت هذه الكتب كلها ام قمت بترجمة لخلقيين؟
    قال الحسن الكتاني: «ما من مسألة اختلف فيها الفقهاء بين مشدد على المرأة وميسّر، فإن ابن حزم يسلك سبيل التيسير، وعنده أن المرأة في الأحكام كالرجل إلا ما خصّه الدليل... وأنظر إلى كثير من الفقهاء، خاصة المتأخرين منهم، فإنهم يلمح من كلامهم استنقاص المرأة والتحجير عليها مرة بحجة قصورها وأخرى بحجة سد الذرائع. وهذا ما لم أجده عند ابن حزم، بل الصالحات منهن عنده صالحات والفاسدات بحسب فسادهن، مثلهن في ذلك مثل الرجال».

  8. #8

    افتراضي

    اقتباس المشاركة الأصلية كتبت بواسطة BStranger مشاهدة المشاركة
    لحظة واحدة، ما المشكلة في الـ"micro-evolution"؟ كما ان الطفرات تستطيع ازال عضو كامل، مثلاً بسبب التسرب الاشعاعي في اليابان ولدت ارانب بتشوهات، مثل عدم وجود آذان، سؤال آخر: هل انت يا أخي أبوحب الله قرأت هذه الكتب كلها ام قمت بترجمة لخلقيين؟
    يبدو أنك لم تقرأ كلامي كاملا أخي سترينجر ...
    أو لم تقرأه أو تستوعبه جيدا ...
    الذي أسموه مايكرو تطور - أو التطور الأصغر - هو المعروف بشواهده والمثبوت بالفعل في الأحياء : ولا اعتراض لنا عليه .. وإن كان في تسميته بالتطور الأصغر تدليس لتمرير أنه صورة مصغرة من التطور الذي يقصدونه - من المفترض - .. وهذه اقتباسات من كلامي :

    من النقطة 31 :
    ونتيجة لهذه الدوجما الرهيبة : والتي تسببت في الخلط (المتعمد) من علماء التطور للتغير الجيني الطبيعي سواء بالتهجين وغيره وبين التطور الخرافي الذي يتخيلونه : فسموا الأول المعترف به في الأحياء بالفعل والبيولوجيا الجزيئية بالتطور الأصغر MicroEvolution - لكي يوحي بأنه مؤدي حتما للتطور الأكبر - وسموا تطورهم الخرافي التخيلي بالتطور الأكبر MacroEvolution : فادعوا بذلك أن التطور هو أساسي في كل العلوم الأحيائية (العملية) والبيوكيميائية اليوم - والمفروض أنهم يقصدون التطور الأصغر لا الأكبر - أقول : نتيجة لذلك يخبرنا مثلا كولين باتيرسون - مدير الحفريات بالمتحف البريطاني للتاريخ الطبيعي قائلا : " علم الأحياء ما بعد الدارويني : وضعه أناس يعتقدون بالغالب بقدسية داروين " !!..
    من النقطة 32 :
    أبدأ هذه المداخلة بمقولة شهيرة لعالم البيولوجيا الجزيئية مايكل بيهي إذ يقول : " الدارونية الحديثة فسرت التطور الدقيق microevolution بشكل رائع .. لكن عند الحديث عن التطور الكبير macroevolution فعلى التطوريون أن يصمتوا " !!..
    وأما بالنسبة لحديثك عن الطفرات وإمكانيتها في (((( إزالة ))))) عضو كامل : فلا أعلم : وما الاعتراض هنا !!!!.. لأن وجه حجتنا على التطوريين ليس في قدرة الطفرات على (((( إزالة )))) عضو كامل كخطأ في النسخ والتضاعف الوراثي : فهذا وارد جدا ومشاهد في البشر والحيوانات ..
    ولكن وجه حجتنا على التطوريين والملاحدة هو في ((( زعمهم ))) قدرة الطفرات على ((( إنشاء ))) أو ((( استحداث ))) صفة تامة جديدة على الكائن أو عضو كامل جديد لم يكونا في الكائن أصلا !!!!.. كزعمهم استحداث الأجنحة مثلا في الزواحف أو الأيدي والأقدام في الأسماك أو الزعانف وفتحة التنفس العلوية في الدببة أو غيرها إلخ ...

    وهذه أيضا بعض الاقتباسات الخاصة بذلك من كلامي :

    النقطة 28 :
    أقول : وأنا كذلك لا أشكك في وجود طفرات ((((عشوائية)))) ولا انتخاب طبيعي ((((عادي)))) لأفراد الجنس (((الواحد))) حسب ظروفهم المحيطة بهم .. ولكن التشكيك ((بل الرفض التام)) هو ادعاء أن الطفرات العشوائية أو الانتخاب الطبيعي : قادران على ((((خلق)))) عضو واحد زائد أو جديد بالكلية عن الكائن الحي !!!!.. وهذا ما سأثبته بإذن الله تعالى أستاذ هشام : بـ (الدليل) و (العلم)
    النقطة 30 :
    ولكن : الرياح أتت التطوريين بما لا تشتهيه الأنفس !!.. فلم تثبت - وإلى اليوم - أية فرضية للتطور ولم يرى البشر مثالا واحدا لتطور كائن من كائن أو حتى ظهور عضو جديد ولا حتى شاهدوا أيا من الطفرات (المعجزة) التي يتخيلها التطوريون !!..
    ومن نفس النقطة أيضا :
    وكذلك الطفرات - وكما سنرى في المداخلة البعد القادمة- فهي أفشل من أن يُنسب إليها إظهار عضو (جديد) في الكائن الحي !!.. بل هي في معظمها ضارة في الأصل .. بالضبط كمَن يمسك بجهاز تلفاز ثم يهزه عشوائيا : فهل أي تغيير بداخل الجهاز من جراء هذا الهز : سيكون مفيدا ؟!!.. هذا الكلام لا يقوله إلا غشاش لنفسه وللعلم .. ولا يصدقه إلا مَن لا يعرف مدى التعقيد والدقة والنظام الذي عليه الخلية الحية والحمض النووي الوراثي وجيناته وشيفراته ..!!
    ومن النقطة 32 :
    فإذا أخذنا مسألة الطفرات : وجدنا ترجمة عملية للخلط (المتعمد) والمشين من جهة التطوريين بين الحقائق !!.. وذلك في استغلال منهم لجهل العوام والبسطاء بالطفرات وحقيقتها وآلياتها !!.. حيث - وإلى اليوم - ما زال يظن الكثير من العوام والبسطاء أن الطفرات : هي قفزة (سحرية) لإكساب الكائن الحي صفة (زائدة) عن جسده أو عضوا (جديدا) : لم يكن موجودا من قبل !!.. وأن هذه الصفة أو هذا العضو الجديد : يكون مفيدا !!!.. أقول : الطفرات هي أخطاء في نسخ الحمض الوراثي أثناء التضاعف !!.. وكونها أخطاء : فهو لا ينتج عنها شيئا مفيدا بالمرة - وهذا من المفترض أن يُعلم بداهة !! -
    وأما بالنسبة لسؤالك أخي :

    سؤال آخر: هل انت يا أخي أبوحب الله قرأت هذه الكتب كلها ام قمت بترجمة لخلقيين؟
    بالطبع لم أقرأها كلها .. وإنما أغلبها من نقولات ما استشهد به هارون يحيى من كتب التطوريين أنفسهم والخلقيين على سواء .. ومنها القليل الذي قمت بتجميعه أو ترجمته بنفسي أو نقله عن إخواني كما ذكرت بعضهم بالأعلى ...

    بالتوفيق ...

  9. #9

    افتراضي

    مناظرة مع الملحد هشام آدم بعنوان : وجود الله ..
    الجزء 4 ...
    جرت هذه المناظرة في جروب (نقاش فكري) على الفيسبوك ..
    وقد انتهت بانسحاب الملحد بأعذار أني أخطأت ولفقت ودلست فيها .. ولله الحمد ..!
    ---------------


    ***
    الأستاذ هشام :
    عفوًا ,, فقط استوقفتني جملتك هذه: "أقول : الطفرات هي أخطاء في نسخ الحمض الوراثي أثناء التضاعف !!.. وكونها أخطاء : فهو لا ينتج عنها شيئا مفيدا بالمرة - وهذا من المفترض أن يُعلم بداهة !!" وأنا أتعجب من الحديث عن أخطاء في كلام من المفترض هو عن "مصمم ذكي" !!!! وما هذا الخلط الغريب في مفهوم الطفرات الجينية؟ كيف لا تحدث عن الطفرات الجينية سمات جديدة جيّدة؟ لقد أوضحتُ لك في بداية كلامي أنَّ هذه الطفرات قد لا تكون مفيدة وقد تكون كذلك أو قد تكون ضارة ,, ونسبة حدوث أي من هذه الثلاثة متساوية تمامًا .... لا تشعرني بالإحباط أرجوك عمومًا ... لا أنكر أنه بدأ السأم يتسرّب إليّ من هذا الحوار، ربما لطوله، وربما للفترات المتباعدة بين ردودنا ... وعلى أيّ حال فإن انشغال كلينا بأموره الخاصة يزيد الأمر تعقيدًا. أكرر أسفي على هذه القفزة "العشوائية" بعد انتهاء مداخلتي.
    ***
    ---------------

    34...

    شكرا أستاذ هشام على المداخلات القيمة .. والتي - وكما قلت لك من قبل - تفيد في توعية وتثقيف القاريء العادي بأقوال الطرفين التي تنتشر اليوم في النت : ورد كل طرف على الآخر فيها .. وبالتأكيد الخيار سيعود في النهاية إلى كل عاقل في اختيار الحق من الباطل .. أو كما نقول نحن (الحق أبلج واضح .. والباطل لجلج مهزوز) .. إذا .. فما علينا - أنا وأنت - إلا توضيح (ثبات) و(منطقية) و(علمية) كل ما ندافع عنه في عقيدتنا بإذن الله .. وبالطبع لن أستطيع الكتابة الآن للأسف للانشغال .. ولكن أعدك أنك ستجد معلومات جيدة جدا في المداخلات القادمة مني إن شاء الله - فالتطور مجالي الحميم منذ أكثر من عام ونصف - سواء معلومات جديدة : أو تصحيح لأخطاء كثيرة لديك إن شاء الله سأوضحها في حينها .. وعلى العموم : أنا لم يداخلني أي سأم من هذه المناظرة أبدا .. بل يعلم الله تعالى مدى سعادتي بها : وأنه لولا مجيئها في وقت انشغال لي بالفعل وظروف خاصة كنت ذكرتها في منتدى التوحيد : لم تكن مداخلاتي تأخرت أبدا عن مداخلاتك .. إذا .. لا داعي للسأم أستاذ هشام بل يمكنك اعتبار الأمر مطارحات فكرية على الأقل : وإذا لم تكن مناظرة .. هذه كانت مداخلة على السريع .. وسأتبعها حين يتيسر قريبا إن شاء الله بمداخلات الردود ..
    ---------------

    35...

    من المتعارف عليه أستاذ هشام أن دفع الملامة عن النفس أولى من جلب الإعجاب أو الشكر لها .. ولذلك فقبل البدء بالردود على ما يخص كلامك عن التطور : فأحب أن أدفع عن نفس أوجه الملام التي وجهتها لي أستاذ هشام .. وحتى لا يظن أحد القراء بي سوءا ً.. حسنا .. >> أول ملامة وجهتها لي : كانت بخصوص ديفيد برلنسكي David Berlinski : حيث تؤكد في كلامك أنه (ليس ملحدا) ولكنه : يهودي .. لاهوتي .. لا أدري .. أقول : وأين قلت أنا أستاذ هشام أنه (ملحد) ؟!!!.. بل قلت - ووضعتها بين قوسين - أنه (لاديني) !!.. ومن المعلوم أن أي لا أدري هو بطبيعة الحال لا ديني : والعكس غير صحيح .. إذا : ما الاعتراض ؟!!.. أو : وهل كذبت أنا أو أخطأت ؟؟.. >> وأما للملامة الثانية بالنسبة لوصفيلتوماس نايجل Thomas Nagel بأنه ملحد : ثم تخطئتك لي بقولك : "" وهو حاليًا أستاذ للفلسفة والقانون بجامعة نيويورك وهو يهودي أصلًا وليس ملحدًا "" .. أقول بداية : دعنا نتفق على أن وصف (يهودي) لا يعني بطبيعة الحال أنه يهودي (الديانة) !!.. بل ينصرف وصف يهودي غالبا إلى كونه (من اليهود جنسية ًأو مكانا) ..! وإلا : فأنشتين أيضا كان يهودي : فهل يعني ذلك أن أقول لك أنه كان مؤمنا بإله مشخص كاليهود ؟!!.. هذا أولا .. وأما ثانيا .. فهو قول توماس نايجل نفسه عن نفسه : I want atheism to be true and am made uneasy by the fact that some of the most intelligent and wellinformed people I know are religious believers. It isn’t just that I don’t believe in God and, naturally, hope that I’m right in my belief. It’s that I hope there is no God! I don’t want there to be a God; I don’t want the universe to be like that المصدر - The Last Word” by Thomas Nagel, Oxford University Press: 1997 ..! >> وأما بالنسبة للملامة الثالثة وهي وصفيلجيري فودور Jerry Fodor بالملحد : ثم تخطئتك لي أيضا بخصوص ذلك وقولك عنه : "" وهو أيضًا يهودي وليس ملحدًا "" .. فكنت أرجو أستاذ هشام (فقط) أن تجري بحثا سريعا على أي محرك بحث على النت مثل جوجل عن عبارة (Jerry Fodor atheism) لكنت وجدت عبارات وعنواين كثيرة تتناول كتاباته الأخيرة في نقد التطور مثل : Being a materialist atheist doesn’t help Jerry Fodor when he is up against Darwinism .. بل وعندما يتم ذكر أسماء اللادينيين والملاحدة الذين يرفضون أبرز الفرضيات العلمية المفروضة على المجتمع العلمي مثل التطور : تجده في المقدمة بكتابه الأخير مع ماسيمو بالميريني : Here are a few more atheists and an agnostic, united by their disquiet over the vast reams of popular beliefs marketed as science today. American materialist atheist Jerry Fodor, has also broken ranks in What Darwin Got Wrong (London: Profile, 2010) .. إذا : ليس كل وصف (يهودي) أستاذ هشام يعني أن صاحبه (مؤمنا) !!!..
    ---------------

    36...

    >> وأما الملامة الرابعة بخصوص تخطئتك لاستشهادي بموقع المناهضين للداروينية وقولك : "" ولمن شاء أن يعترض على التطوّر لأسباب دينية تخصّه، فله أن يذهب ويسجّل اسمه في قائمة المناهضين للداروينية. وعلى ذكر هذه القائمة فإنَّني لم أجد أسماء كلٍ من: توماس نايجل وجيري فودور وماسيمو بالماريني، فهل نسوا أن يوقعوا أم ماذا؟ "" أقول : وهل أخبرتك أستاذ هشام بأنه (لزاما) على كل عالم أو دكتور يناهض التطور الدارويني : أن يسجل فيها ؟؟.. بل عدم تسجيل البعض فيها هو دليل على عدم حصر المناهضين للتطور الدارويني وآلياته بهذه القائمة (الطويلة جدا) فقط !!!.. وهذا لا شك مما يفرحني أنا لا أنت ..!! وعلى العموم : تجد مايكل بيهي فيها وهناك حركات مماثلة بدأت في الظهور من سنوات - وخصوصا في أمريكا - تدعو لرفع التضييق عن الدكاترة وبروفيسورات الجامعات لتدريس ما يؤمنون بصحته وعلميته : وذلك برفع (جبر) خرافة الداروينية عنهم !!.. وذلك مثلacademicfreedompetition .. وإليك نص عريضتهم التي يوقعون عليها ليطالبوا بـ (حرية الرأي في العلم) !!.. حيث يظهر من كلامهم مدى الضغط الرهيب على الطلاب والمعلمين والدكاترة في أمريكا : وإذا ما هم فقط فكروا في نقد التطور الدارويني وآلياته !!!.. تقول العريضة : We, the undersigned American citizens, urge the adoption of policies by our nation's academic institutions to ensure teacher and student academic freedom to discuss the scientific strengths and weaknesses of Darwinian evolution. Teachers should be protected from being fired, harassed, intimidated, or discriminated against for objectively presenting the scientific strengths and weaknesses of Darwinian theory. Students should be protected from being harassed, intimidated, or discriminated against for expressing their views about the scientific strengths and weaknesses of Darwinian theory in an appropriate manner .. >> وأما الملامة الخامسة بتشكيكك في موقع المناهضين للداروينية - ربما محاولة منك للتشكيك في عددهم الكبير - وذلك بقولك : "" كما أنَّ هنالك أسماء لم أجد لها أثرًا على قوقل على الإطلاق، فهل هي أسماء وهمية كما نجد في صناديق اقتراع الانتخابات في الدول العربية؟ "" .. أقول : لا أستاذ هشام .. بل لو أنك أخذت جولة سريعة في الموقع لعرفت نظام التسجيل وشروطه .. والتي تنطبق على دكاترة عادييين في أي مكان في العالم (الشرط الوحيد هو أن يكونوا من الاختصاصات المحددة في صفحة الأسئلة والاستفسارات وصفحة التوقيع للانضمام للقائمة) أو الأكاديميات العلمية .. والشاهد : أنه ليس بالضرورة أن يكونوا أناسا مشهورين تجدهم على الجوجل ولكل منهم صفحة على الويكيبديا !!!!!.. >> وأما الملامة السادسة في قولك : "" قد أتفهم أن يعارض عالم بيولوجيا أو كيمياء حيوية أو عالم أجنة نظرية التطور، ولكن لم أفهم أن أجد لها معارضين ليست لهم علاقة بهذا التخصص كالمهندسين الميكانيكيين والإلكترونيين كأخينا جون كوقديل هذا (John Cogdell Professor of Electrical & Computer Engineering University of Texas) أليس غريبًا؟ "" أقول : لو أنك نظرت بالفعل في صفحة الموقعين على القائمة وتخصصاتهم : لوجدت أنهم حددوا هذه الاختصاصات بكل دقة : حيث ترتبط جميعها بإثبات (احتماليات) التطور والطفرات : كيميائيا ورياضيا وبيولوجيا إلخ من عدمها !!.. تقول صفحة Sign the List في التخصصات المطلوب إرسال شهاداتها : Signers of the Scientific Dissent From Darwinism must either hold a Ph.D. in a scientific field such as biology, chemistry, mathematics, engineering, computer science, or one of the other natural sciences; or they must hold an M.D. and serve as a professor of medicine. Signers must also agree with the following statement .. >> وأما الملامة السابعة في تعليقك على ذكري لوجود (أخطاء) تقع أثناء النسخ أو التضاعف في الحمض النووي بقولك : "" وأنا أتعجب من الحديث عن أخطاء في كلام من المفترض هو عن "مصمم ذكي" !!!! "" أقول : وهل أخبرك أحد أستاذ هشام أن بروتينات وإنزيمات نسخ وتضاعف الحمض النووي للخلايا الحية : لا تتأثر دوما بما حولها من اضطرابات كيميائية يتسبب فيها الكائن الحي لنفسه (مثل تناول أدوية أو مسكرات أو أشياء لها تأثير كيميائي على خلاياه) أو اضطرابات خارجية (مثل التعرض للإشعاع ونحوه) ؟!!.. والكلام بمعنى آخر أبسط وأسهل أستاذ هشام هو : هل عندما أقوم بتصنيع ثلاجة محكمة : وتعمل على ما يرام - كمثال للتصميم الذكي - : هل عندما يصيبها العطب والعطل بسبب خارجي مثل هزة شديدة أو زيادة في التيار الكهربي أو وضع الطعام بصورة خاطئة تسد منافذ التبريد فيها أو عدم تصريف المياه إلخ إلخ : فهل مثل هذه الأخطاء : تطعن في كون الثلاجة أتت من تصميم ذكي و(بفعل فاعل حكيم له غاية) ؟!!!.. وأما العجب أستاذ هشام : فهو أن تلفت لإمكانية وقوع أخطاء - وهذا شيء ممكن ووارد بأسباب خارجية وليست خطأ في الخلق والتصميم - : ولا يلفت نظرك كون هذه الأخطاء يتم الكشف عنها وإزلتها أو تصحيحها ذاتيا !!!!.. مما يعني فهما ووعيا وعقلا وإرادة تعمل على التقييم والتصرف !!!.. وذلك من أبسط مكونات المادة التي لم يثبت كيميائيا ولا فيزيائيا أنه لها إرادة خاصة مثل الذرات والجزيئات !!!.. يتبع إن شاء الله ..
    ---------------

    37...

    حسنا أستاذ هشام .. وقبل أن أستعرض معك باقي نقاطك في ردودك : أود أن أشير إلى شيئين .. الأول.. هو أني لا أريدك أن تتأثر سلبا في مناظرتنا معا بأي مؤثر خارجي .. وأما الثاني : فهو أني - وعلى عكسك تماما - لا أضيق ذرعا بطول الكتابة أو المداخلات أو المشاركات : ما دامت كلها في أصل الموضوع ولم تتشتت .. وطالما كان الطرف الآخر مهذبا .. بل هذا مدعاة للاهتمام الزائد وبذل الجهد أكثر في استثمار واستغلال مثل هذه الفرص التي قل أن تتكرر .. على العموم لن أطيل عليك .. ولنبدأ ..>>> أنت قلت أستاذ هشام : "" المهم لديَّ هنا يا عزيزي أنني قدمتُ في مداخلتي السابقة شرحًا مبسطًا لفكرة التطوّر والانتخاب الطبيعي على مستوى بكتيري، لأنَّ هذا يمكن ملاحظته ومتابعته في فترة وجيزة بحكم أنَّ دورتها الحياتية قصيرة، ولكن التطوّر نفسه يحدث بذات الكيفية مع الكائنات الأخرى، ولكن تصعب ملاحظته، لأنَّها تتطلب فترات زمنية أطول لملاحظتها عيانيًا، وربما يتطلب الأمر فترات تتجاوز آلاف السنوات، ولهذا فإنَّه يصعب للكثير التصديق بذلك، ولهذا نلجأ في بعض الأحيان للمستحثات والأحفوريات، ولكني لم أعرف رأيكَ في هذا الشرح "" .. أقول : بل أخبرتك برأيي أستاذ هشام .. وأكون سعيدا جدا جدا لو تستطيع نقده !!.. وأعتقد أن (حصر) حديثك على البكتريا والفيروسات إلخ وما يحدث فيهم من (تكيف) وليس (تطور) : هو محاولة لتشتيت النظر بعيدا عن حقيقة غياب (أي) أدلة فعلية على (التطور) الحقيقي الذي تدعيه فرضية التطور !!.. وأما محاولة التبرير بأن سبب حصر الكلام في البكتريا والفيروسات هو بسبب أن أطوال عمرهما قصيرة : فيظهر فيها علامات التطور أكثر من غيرها من الكائنات الحية الأعقد تركيبا والتي تأخذ فترات أطول بكثير قد تصل لآلاف السنين .. أقول : هذا الكلام يوقعك في مأزق أستاذ هشام مرتين !!!.. مرة بالنسبة للبكتريا والفيروسات : لأنها طوال مئات السنين وهي (((ما زالت))) بكتريا وفيروسات !!!!.. بالرغم من أن قصر أطوال عمرها من المفترض أن يصاحبه ((سرعة طفرات وتطور)) أكبر من سائر الكائنات والإنسان مثلا !!!.. ولكن هذا لم يحدث !!.. ولا يحدث !!.. ولن يحدث !!!!!.. فما زالت البكتيريا والفيروسات منذ مئات الملايين من السنين : هي هي !!!.. حسنا .. وما هو المأزق الثاني الذي يوقعك فيه مثل هذا التبرير أستاذ هشام ؟؟.. أقول : هو مأزق أن التطور ((البطيء)) جدا للكائنات الحية الأعقد : يعني أن كل طفرة على مسيرة التطور : كان يتم السكوت عليها وغض النظر عنها من جانب الانتخاب الطبيعي !!!.. ورغم أنها لم يكن لها فائدة لوقت طويل !!!!.. - اللهم إلا إذا كان الانتخاب الطبيعي له وعي هو أيضا وعلم وحكمة وتصميم : ويعرف أن هذه الطفرة أو تلك : لها مستقبل باهر في آلاف أو ملايين السنوات القادمة : فيستبقيها - !!!!.. والشاهد : أنه كيف يدعي المؤمنون بالانتخاب الطبيعي أنه يقصم ظهر الطفرات الغير مفيدة أو غير مرغوب فيها : ثم من جهة أخرى يدعون ((أعمارا بالغة الطول)) لوقوع طفرات التطور : من غي أن تمتد إليها يد الانتخاب الطبيعي لتقصمها ؟!!.. بالمصري كده ممكن أتساءل : هل هي كوسة يعني ؟!!.. واسطة ؟!!.. >> هذا بالنسبة لأحد أوجه النقد القوية و(العملية) الموجهة للانتخاب الطبيعي (مع) الطفرات أستاذ هشام .. وهو غير النقد الخاص بكل منهما على حده والذي ذكرته لك من قبل : ولا داعي لتكراره من جديد ... فهذا هو رأيي فيما قلته أنت .. وهو أني أؤكد (ومن جديد) : أنه لا دليل واحد عملي حقيقي على وقوع التطور !!.. لا في الماضي ..! ولا في الحاضر ..! فإن كان لديك : فاعرضه أستاذ هشام لنتحاور فيه سويا ابتغاء الحق إن شاء الله : وبالعلم .. لا بغيره .. وكما وعدتك وحافظت على وعدي إلى الآن -وسوف أرد عليك مثال تطور سحلية الحائط الإيطالية P. sicula ومثال الأفاعي المجلجلة - .. ولكن دعني أعلق على قولك : "" ولهذا نلجأ في بعض الأحيان للمستحثات والأحفوريات "" وذلك في المداخلة القادمة ...
    ---------------

    38...

    لعلك تعرف أستاذ هشام أنه ومنذ وضع داروين فرضيته عن التطور في كتابه : وكان يدرك تماما أن واحدة من أهم مستلزمات (الانتخاب الطبيعي) هي وجود ملايين الحفريات والمستحاثات للكائنات الحية منذ القدم : والتي تترجم لنا الظهور (العشوائي) للصفات المحتملة الكثيرة جدا - طالما كانت الصدفة هي التي تخلق - في مقابل ما قام (الانتخاب الطبيعي) باصطفائه مما نراه اليوم من كائنات حية تعيش حالة الاستقرار .. أقول .. كان داروين يدرك ذلك : وذكره أكثر من مرة في كتابه أصل الأنواع ولكن .. ولأنه يعلم أنه ولا حفرية ولا مستحاثة واحدة قد وجدها البشر تترجم ما زعم : فقد أوكل كل ذلك للمستقبل .. وللاكتشافات التي ستستجد .. والآن .. وبعد مضي ما يقارب القرن والنصف .. وبعد اكتشاف أكثر من 250 مليون حفرية ومستحاثة مختلفة تشمل كافة العصور الجيولوجية التي عاصرتها الكائنات الحية منذ أكثر من 500 مليون سنة : فقد باءت توقعات وأحلام وفرضيات ومزاعم داروين - والتطوريين - كلها بالفشل !!.. بل ولا أكذب إذا قلت أنه كثيرا ما كان اكتشاف حفرية واحدة فقط : تزلزل شجرة التطور وتأتي بعاليها أسفلها وأسفلها عاليها : حتى تم استبدال معظمها اليوم بأشكال (وفرضيات) جديدة : ما زالت أيضا تفتقد إلى (السلف المشترك المزعوم) عند كل تفرع !!!!.. وهنا ظهرت معضلة جديدة أخرى حاول التطوريون كثيرا إخفائها عمدا !!.. تارة بعدم الحديث حولها أو حتى الإشارة إليها أو إثارتها !!.. وتارة بافتعال الحفريات لكائنات وسطية (هجين) بين الأنواع !!.. وتارة بإخفاء الحفريات الحقيقية التي تفضح عدم وجود تطور في أقبية المتاحف العلمية والطبيعية والأحيائية !!.. وهذه المعضلة هي : أن حفريات الكائنات الحية منذ ظهورها في السجل الحفري منذ عشرات ومئات الملايين من السنين وإلى اليوم : هي هي كما نعرفها ((ولم تتغير)) !!.. فأنواع الأسماك كما هي - منها ما يعود لأكثر من 450 مليون سنة مثل سمكة الكوالاكينت - !!.. وكذلك العديد من أنواع الزواحف - تماسيح سحالي - والبرمائيات - ضفادع سحالي - والثدييات والطيور !!!.. وبمعنى آخر : فإن أي حيوان لم ينقرض : فهو هو منذ ظهوره في السجل الحفري وإلى اليوم لم يتغير !!.. فأين هو التطور منذ ملايين السنين ؟!!.. وأين هي تلك الطفرات التي ((توقفت)) عن العمل فجأة منذ دهور مديدة : وعندما رضي الانتخاب الطبيعي - فيما يبدو- عن النتائج في كل نوع !!!!.. فهذه معضلة في الحفريات وهي (الظهور المفاجيء) في السجل الحفري بلا مقدمات ولا تتدرجات ولا كائنات وسيطة بين الأنواع : ثم (الثبات) في حفريات كل نوع من ظهوره : وإلى اليوم !!.. وللعلم أستاذ هشام : هذا ليس (كلامي) ولا كلام (الخلقيين) ولا (المؤمنين) كما كررتها أكثر من مرة في مداخلاتك الأخيرة ويعلم الله تعالى أن معظم ما أنقله لك هو من كلام علماء في التطور أنفسهم !!!.. وسأتعرض لذلك في حينه .. ولكني أتركك الآن مع نفس الحقيقة السابقة ولكن على لسان عالم التطور الشهير ستيفن جاي جولد Stephen Jay Gould وهو عالم الحفريات المؤيد للتطور في جامعة هارفارد حيث يقول : " إن تاريخ معظم الحفريات يحتوي على صفتين لا تتماشيان مع التدرج في إيجاد الكائنات الحية : الأولى : هي الاتزان والاستقرار ..! حيث لا تتغير طبيعة الكائنات طوال مدة بقائها على الأرض !!.. فالكائنات الموجودة في سِجِلّ الحفريات تظهر وتختفي كما هي دون حدوث تغيرات عليها !!.. وإن حدثت تغيرات فإنها تكون تغيرات طفيفة وفي الشكل الخارجي : وليست باتجاه أي تطور !!.. الصفة الثانية : وهي الظهور المفاجئ !!.. حيث في أي منطقة : لا تنشأ الأنواع الجديدة تدريجيا منحدرة من كائنات أخرى !!.. وإنما تظهر فجأة : وبتركيب مكتمل تماما " !!.. المصدر - Gould, Stephen J. The Panda's Thumb, 1980, p. 181-182 .. ولعل هذا الكلام منه يقودنا إلى معضلة أخرى ترسم أكبر علامة استفهام للتطوريين وهي : معضلة الظهور المفاجيء لأشكال الكائنات الحية اللافقارية المعقدة في فترة الانفجار الكمبري !!!.. يشرح لنا ذلك ريتشارد موناسترسكي Richard Monastersky : الكاتب في جريدة ساينس نيوز Science News journal فيقول : "قبل نصف بليون سنة ... ظهرت فجأة أشكال الحيوانات شديدة التعقيد التي نراها اليوم !!!.. وترمز تلك اللحظة في بداية العصر الكمبري للأرض - أي قبل نحو 550 مليون سنة - إلى الانفجار التطوري الذي ملأ البحار بأولى الكائنات المعقدة في العالم " !!.. المصدر - Richard Monastersky, “Mysteries of the Orient,” Discover, April 1993, p. 40, (emphasis added .. وحتى الملحد ريتشارد داوكينز نفسه Richard Dawkins لم يستطع التهرب من الاعتراف بتلك المعضلة والعلامة الاستفهام أمام التطور المزعوم حيث يقول في كتابه (صانع الساعات الأعمى) : "على سبيل المثال : تعتبر طبقات الصخور الكامبرية (التي يبلغ عمرها حوالي 600 مليون سنة) : أقدم الطبقات التي وجدنا فيها معظم مجموعات اللافقاريات الأساسية ..! ولقد عثرنا على العديد منها في شكل متقدم من التطور في أول مرة ظهرت فيها ..!! ويبدو الأمر وكأنها زُرعت لتوها هناك : ودون أن تمر بأي تاريخ تطوري !!.. وغني عن القول أن مظهر عملية الزرع المفاجئ هذا : قد أسعد المؤمنين بالخلق" !!.. المصدر - Richard Dawkins, The Blind Watchmaker, London: W. W. Norton 1986, p. 229 .. وهي إحدى المعضلات التي حاول تبريرها بنظرياته العديدة في كتبه ..
    ---------------

    39...

    ولذلك كله أستاذ هشام رأينا على مدى القرن والنصف الماضيين : عشرات الأكاذيب التطورية التي لولاها ولولا الترويج لها إعلاميا على أنها حقائق معتمدة واقعة بالفعل : ما كان انخدع بها العوام والبسطاء وغير المتخصصين بل : وبعض الشيوخ المسلمين الذين حاولوا التوفيق بينها وبين القرآن والسنة بأي وجه - وسترى أنهم معذورين مع كم الكذب التطوري التالي - !!.. حيث دعني أستعرض معك - ومع كل قاريء - طائفة من هذه الأكاذيب التطورية : وعندي تفصيل أي أكذوبة منها إذا أردت -فقط اطلب - 1- أكذوبة رسومات هيجل لتطور الجنين الإنساني : والتي ما زالت موجودة إلى اليوم في أكابر كتب التشريح المعتمدة في كليات الطب : رغم اعتراف هيجل نفسه بذلك الغش والتدليس منذ 1908م (غش لما يقارب الـ 90 سنة) !!!.. ثم يأتي الخداع بافتعال الحلقات الوسطية بين الإنسان وسلفه الأشبه بالقرود مثل : 2- إنسان بلتادون والذي تم بنائه على أثر جمجمة إنسان معاصر عوملت بمحلول ديكرومايت البوتاسيوم للتمويه + فك قرد أورانجتون + أسنان (40 سنة غش) !!... 3- إنسان نبراسكا(بضع سنوات من الغش بواسطة ضرس واحد يتيم لخنزير !) !!.. 4- إنسان جاوا والذي تم بناء خدعته على مرتين .. مرة بواسطة فك سفلي وسن واحد !!.. وفي الثانية عظمة فخذ (30 سنة غش) .. 5- إنسان النياندرتال (والذي ثبت أنه إنسان عادي بعد ما يقارب 104 سنة) !!.. 6- جمجمة القرد Zinjantrophus (غش لمدة عام) ..! 7- متحجرة Ramapithecus (غش لمدة 15 سنة) ..! 8- أردي 9- لوسي (كل منهما غش لبضع سنوات) !!.. 10- سمكة الكوالاكنث (غش استمر لعشرات السنين أنها سمكة منقرضة وأنها التي تحولت زعانفها إلى أيدي وأقدام : ثم تم اصطيادها عام 1938م !!.. ثم تم اصطياد أكثر من 200 سمكة منها في الأعوام التالية لتنهدم كذبة أخرى !) .. 11- مثال الفراشات الفاتحة اللون والغامقة اللون (غش منذ أكثر من 30 عاما وإلى اليوم !!) .. وخير مَن فضح صاحبه Bernard Kettlewell هو عالم الأحياء الجزيئية (Jonathan Wells) في كتابه (Icons of Evolution) حيث بين كيف تلاعب بيرنارد في عرضه للحالة (حيث هذه الفراشات تعيش أصلا تحت أوراق الشجر وليس على الجذوع !!.. وأيضا قد صورها بيرنارد وهي ميتة ثم قام بتثبيتها على الجذوع) !!.. إلخ 12- حفرية الطائر أركيوبتريكس (غش إلى عام 2000م ولكنه ما زال يستخدمه التطوريون إلى اليوم !) وهي حفرية لطائر ادعى التطوريون أنه الديناصور جد الطيور !!.. والذي عاش منذ 150 مليون سنة .. ولكن في عام 2000م تم اكتشاف حفرية طائر عمره 220 مليون سنة !!.. أي يسبق الأركيوبتريكس بـ 75 مليون سنة !!.. هذا غير أن الأركيوبتريكس أصلا طير وليس ديناصور كما أثبتت الأبحاث !!.. 13- الحفرية سيناصوروبتركس 1996م والتي زعم التطوريون أنها لديناصور بريش : ثم ثبت بعدها أن الموجود في الحفرية لا يمت للريش بصلة (غش لبضعة أشهر) !!.. 14- الحفرية أركيورابتور لياونِنجنسز 1999م والتي زعموا أنها أيضا لديناصور بريش عاش منذ 125 مليون سنة !!.. ولكنه لم يمض عام واحد حتى تم اكتشاف الغش المتعمد عن طريق تركيب ولصق عظام وأجزاء 5 عينات لخمس حفريات منفصلة !!.. وتم كشف ذلك عن طريق بمساعدة التصوير المقطعي بالأشعة السينية عن طريق الكمبيوتر !!.. << وبمناسبة هذا الديناصور الزائف : وبمناسبة اعتداد الأستاذ هشام بالناشيونال جيوغرافيك : فلا يسعني أن أذكر هنا فضيحة تواطؤ مجلة الناشيونال جيوغرافيك على نشر أكذوبة هذا الديناصور الطائر المزيف : رغم معرفتها السابقة بهذا الغش !!!!.. وقد ذكر تفاصيل كل ذلك ستورس إل. أولسون Storrs L. Olson : رئيس قسم علم الطيور بالمعهد السِّمِثسوني الأمريكي الشهير .. وأنقل هنا إحدى أقواله من تصريح له لصحيفة يو. إس. إيه توداي USA Today حيث قال :" تكمن المشكلة في أن الناشونال جيوجرافيك عرفت في وقت من الأوقات أن الحفرية مزيفة !!.. لكن هذه المعلومات ظلت في طي الكتمان " !!.. المصدر - Tim Friend, "Dinosaur-bird link smashed in fossil flap," USA Today, 25 January 2000, emphasis added..! >> وأستكمل : 15- حفرية جد الحيتان Rodhocetus !!.. والذي قام فيليب (أو فيل) جنكريخ F. Gingerich مكتشفها - وهو مدير متحف الحفريات جامعة ميتشيغان - بتلفيق صور لها بزعانف خلفية كبيرة - لكي يقرب شكلها من الحيتان - وببقايا أقدام مكذوبة : في حين لا تحتوي الحفرية على أي ٍمن ذلك حقيقة !.. وكما فضحه كارل فيرنر Carl Werner في لقائه معه والذي نقله بالتفصيل في كتابهEvolution: The Grand Experiment - Volume 1 by Dr Carl Werner, pg 143 - وتم تسجيلها فيديو !!.. وأكتفي بهذا القدر من الأمثلة لعدم التطويل ..
    ---------------

    40...

    وعلى الهامش أود الرد على محاولة إظهار اعتمادي على أقوال علماء (غير محايدين) أو (مخادعين) ! أقول : العجيب أستاذ هشام هو أني أحاول دوما أن أحتج عليك بأقوال : هي من ((اعترافات)) علماء تطوريين أنفسهم !! فلماذا التشكيك في كلامي إذا سمحت ؟! بل وحتى لو فرضنا أنهم ((كلهم)) كانوا متدينيين أو خلقيين : فلماذا لا تنظر إلى كلامهم ((العلمي)) وتقيمه : وبغض النظر عن عقيدتهم ودينهم ؟!.. ولله دره القائل : " لا تنظر إلى مَن قال .. وانظر إلى ما قال " ! ومن هنا .. فإليك باقة من اعترافات ((التطوريين)) أنفسهم في شتى معضلات التطور ! 1- فهذا التطوري ديريك آجر Derek V. Agerيعترف قائلا : " تتمثل نقطة الخلاف في أننا إذا فحصنا سجل المتحجرات بالتفصيل : سواء على مستوى الترتيب أو الأنواع : فسنكتشف -مراراً وتكراراً- عدم وجود تطور تدريجي ! بل انفجار فجائي لمجموعة واحدة على حساب الأخرى " ! 2- وهذا التطوري باتيرسون Patterson وهو أحد مسئولي المتحف البريطاني للتاريخ الطبيعي في لندن يقول : " لم يحدث أبدا ًأن وُجِد كائن حي بعملية الانتقاء الطبيعي ! ولم يقترب أي أحد حتى من تحقيق هذا الشيئ " ! 3- وهذا التطوري عالم المتحجرات مارك سيزارنكي Mark Czarnecki يعترف : " إن المشكلة الأساسية في إثبات النظرية تكمن في سجل المتحجرات - أي آثار الأنواع المنقرضة المحفوظة في التكوينات الجغرافية للأرض - ! فلم يكشف هذا السجل قط أية آثار للأشكال المتوسطة التي افترضها دارون ! وعوضاً عن ذلك : تظهر الأجناس وتختفي فجأة ! ويدعم هذا الشذوذ حجة دعاة الخلق القائلة بأن الأنواع قد خلقها الله " ! 4- وهذا أحد محرري مجلة علوم الأرض الداعمة للتطور وهو ريتشارد موناسترسكي Richard Monastersky يقول : " قبل نصف بليون سنة : ظهرت -فجأة- أشكال الحيوانات التي نراها اليوم ! والتي تتسم بقدر لافت للنظر من التعقيد ! وتعد هذه اللحظة عند بداية العصر الكامبري للأرض بالضبط - أي قبل حوالي 550 مليون سنة - علامة على الانفجار التطوري الذي ملأ البحور بأول كائنات معقدة في العالم ! وكانت شعب الحيوانات الكبيرة التي نراها اليوم : موجودة بالفعل في أوائل العصر الكامبري !!.. وكانت تتميز عن بعضها البعض بنفس القدر الذي تتميز به عن بعضها البعض اليوم " ! 5- ويعترف التطوري دوغلاس فوتويما Douglas J. Futuyma فيقول : " إما أن تكون الكائنات الحية قد ظهرت على وجه الأرض وهي كاملة التطور : وإما أنها لم تظهر ! وإذا لم تكن قد ظهرت في شكل كامل التطور : فلابد أنها قد تطورت من أنواع كانت موجودة من قبل عن طريق عملية تحور ما ! وإذا كانت قد ظهرت في شكل كامل التطور : فلا بد أنها قد خلقت بالفعل بواسطة قوة قادرة على كل شيء " ! 6- ويعترف عالم المتحجرات السويسري التطوريستيفن بنغستون Stefan Bengston بعدم وجود حلقات انتقالية أثناء وصفه للعصر الكامبري قائلاً : "إن هذا الوضع الذي أربك دارون وأخجله : ما زال يبهرنا " ! 7- وفي ذلك يقول عالم المتحجرات التطوري جيرالد تود Gerald T. Todd : " لقد ظهرت الأقسام الثلاثة الفرعية للأسماك العظمية في سجل المتحجرات لأول مرة في نفس الوقت تقريباً ..! وتختلف هذه الأسماك فعلياً اختلافاً واسعاً عن بعضها البعض من الناحية الشكلية ..! كما أنها مصفحة بقوة ..! فكيف ظهرت هذه الأسماك ؟!.. وما الذي سمح لها بهذا الكم الواسع من الاختلاف ؟! وكيف أصبحت جميعها مصفحة بقوة ؟! ولماذا لا يوجد أي أثر لأشكال متوسطة بدائية " ؟! 8- ويعترف التطوري الشهير روبرت كارول R. L. Carroll.فيقول : " ليست لدينا متحجرات متوسطة بين الأسماك الرايبدستية (والتي يحبذ كارول اعتبارها أسلافاً للحيوانات التي تدبّ على أربعة أقدام) وبين البرمائيات الأولى " ! " الزواحف الأولى : كانت مختلفة جداً عن البرمائيات !!.. وأنه لم يتم العثور على أسلافها بعد " ! 9- ويقول عالما المتحجرات التطوريان :كولبرت Edwin H. Colbert ومورالز M. Morales : " لا يوجد أي دليل على وجود أية برمائيات تعود إلى العصور القديمة : وتجمع بين الصفات المتوقع وجودها في سَلَف واحد مشترك ! إذ إن أقدم الأنواع المعروفة من الضفادع والسمندرات والسِسيليات : تشبه بدرجة كبيرة أسلافها الحية " !10- ويقول أنكين قورور Engin Korur أحد دعاة التطور الأتراك : "إن الخاصية المشتركة في العيون والأجنحة : هي أنهما لا تؤديان وظائفهما إلا إذا اكتمل نموهما ! وبعبارة أخرى : لا يمكن لعين نصف نامية أن ترى ! ولا يمكن لطائر أجنحته نصف مكتملة أن يطير ..!! وفيما يتعلق بالكيفية التي تكونت بها هذه الأعضاء : فإن الأمر ما زال يمثل أحد أسرار الطبيعة التي تحتاج إلى توضيح " ! 11-ويعترف التطوري ألان فيدوتشيا من جامعة كارولينا الشمالية قائلا : " حسناً .. لقد درست جماجم الطيور لمدة خمس وعشرين سنة .. وأنا لا أرى أي وجه تشابه بينها وبين جماجم الديناصورات ! إن نظرية تطور الطيور من كائنات ذات أربع أرجل : هي في رأيي وصمة عار على جبين علم البالانتولوجيا في القرن العشرين " ! 12- ويقول التطوري هـ. بروس H. Brush أستاذ الفسيولوجيا والبيولوجيا العصبية من جامعة كنكتكت : " كل مقوم - بدءاً من بنية الجينات وتنظيمها حتى النمو والتشكل وتنظيم النسيج - مختلف في ريش الطيور وقشور الزواحف " ! " ولا يوجد دليل من المتحجرات على أن ريش الطيور قد تطور من قشور الزواحف ! بل على العكس : يظهر الريش فجأة في سجل المتحجرات : وبوصفه صفة فريدة -بشكل لا يمكن إنكاره- تتميز بها الطيور ..!! وبالإضافة إلى ذلك : لم يكتشف حتى الآن في الزواحف أي تركيب للبشرة : يوفّر أصلاً لريش الطيور " !
    ---------------

    41...

    أستاذ هشام .. وعلى الرغم من سعادتي باستحفازك على الكتابة من جديد وبصدر رحب على ما يبدو وهذه بشارة خير على استكمال الحوار الهاديء المفيد مرة أخرى .. إلا أني لم أقل (((انتهيت))) كما اتفقنا !!!!.. وكل ما هنالك أنني لم أكتب بعد بقية ردودي على مداخلاتك السابقة .. فإذ بي أصحو اليوم لأجد 6 آخرين .. على العموم .. لا مشكلة لدي إطلاقا في الرد على كل ما تراه أدلة على التطور .. ولا مشكلة عندي في الإجابة على تساؤلاتك بالمرة - فأغلبها إن لم يكن كلها قد أجبت عليه من قبل بالفعل -ولكن مشكلتي الوحيدة هي في الوقت كما أخبرتك من قبل والإخوة المشرفين على المناظرة - على العموم .. أرجو - ومن جديد - الإلتزام باتفاقنا على عدم وضع مداخلات جديدة إلا بعد انتهاء الطرف الآخر من مداخلاته بكتابة ((انتهيت)) وشكرا مقدما ...


    ***
    إدارة المناظرة :
    ارجو من الاستاذ هشام عدم الاستمرار هكذا ,, متجاوزا ما اتفق عليه من شروط ,, وهي ان يكتب المناظر مداخلته كاملة ,,ثم يختمها بكلمة ( انتهيت ) ,,,اظن ان الاستاذ هشام لم يلاحظ تنبيهنا السابق له !!!!!!!!!!!!


    ***
    لا اعتراض عندي أخي أبو ذر .. وإنما كل ما أرجوه منكم ومن الأخ هشام فقط قبول عذري في التأخر في الكتابة .. فكم يعلم الله مدى انشغالي - أعمل على قضية رسمية شخصية الآن وأقوم باستكمال أوراق شهود ونحوه بالإضافة لوقت العمل الذي يستمر لـ 10 ساعات على ما ذكرت من قبل .. فأرجو التماس العذر - هدانا الله وإياكم إلى ما يحب ويرضى .. وسأحاول ألا أدخر مداخلاتي لأنزلها مرة واحدة .. بل كلما انتهيت من مداخلة أو مداخلتين سأضعهم بإذن الله تعالى حتى لا يشعر المتابع بأي انقطاع أو فتور .. والله المستعان ..
    ---------------

    42...

    بالطبع - ولكثرة عدد المداخلات التي صارت بين يدي من الأستاذ هشام - ولتعذر فرد كل المداخلات على الفيسبوك لتعقب كل ما فيها بعكس المنتديات .. فسأقوم بالرد على أبرز النقاط التي قرأتها في ردود الأستاذ هشام وربما بغير ترتيب .. فليعذرني >>> أما بالنسبة لمسألة نسبة بعض العلماء لليهودية والإلحاد أو اللادينية أو اللاأدرية : فقد بينت لك أستاذ هشام أنه ربما كان اليهود هم ((الوحيدون)) الذين يجمعون بجانب الوصف الديني لكلمة (يهود) : وصفا يتعلق بالجنس والمولد والمكان والأصل واللغة !!.. ولا شك أنك تعرف - ربما أكثر مني - سر هذا التميز والفرادة لهم من بين الأمم .. والدراسات والقصص العالمية التي سطرت ذلك كثيرة ومعروفة .. وعلى العموم .. فقد عرضت ما عندي .. وقد عرضت ما عندك .. ونترك الحكم للقاريء .. >>> وأما بالعودة لنقطة ((وعي)) الخلايا الحية أقول : كل شيء في الكون له وعي : لأنه مخلوق لله تعالى بالفعل : منفعلا بأمره وهدايته له .. ولا يحيد عما خطه الله تعالى له في نظام حياته إلا الإنسان - يقول عز وجل في سورة الإسراء : " تسبح له السماوات السبع والأرض ومن فيهن وإن من شيء إلا يسبح بحمده ولكن لا تفقهون تسبيحهم " .. أقول .. ولكن : لماذا تصر دوما أستاذ هشام أن تخلط بين (الوعي الذاتي) للخلية أو الجزيء أو الذرة إلخ : وبين مفاهيم (العقل) و(حرية الاختيار) و(الإبداع) و(الاختراع) و(الابتكار) و(الذكاء) ؟؟؟؟.. بمعنى آخر .. هل كل واعي : هو عندك يكون له حرية إرادة وقدرة على التصميم والابتكار ؟؟.. إن قلت نعم : قلت لك هذه هي المواد والذرات والجزيئات بمفردها : لا نرى لها ما تنسبه إليها من حرية إرادة أستاذ هشام !!.. بل تلتزم بالتجارب العلمية وسلوكياتها الفيزيائية والكيميائية بغير رفض !!!.. وإن قلت لا : لقلت لك إذا : أنت توافق معي على (ضرورة) وجود هادي لكل هذه الأشياء بما فيها الخلايا الحية ذاتها : هو الذي ألهمها وظائفها في الحياة وكيف تسلك وكيف تتفاعل وتقرأ الشيفرات الوراثية وتنسخ وتصحح إلخ إلخ .. ورغم أني أعلم أن هذا الكلام قد أخبرتك به مسبقا : ولكن دعني أسوقه لك بأدلة منطقية وأمثلة بسيطة : ربما حظت هذه المرة منك بقراءة متأنية وتحكيم رأيك فيها بحيادية .. سوف أقوم أستاذ هشام بتشبيه الخلية الحية بأحد أفراد عرض رياضي في مدرسة : مطلوب منه أن يصطف مع زملائه الكثيرين في أرض الملعب ليكونوا معا عبارة : " مرحبا بكم في حفلنا اليوم " .. والسؤال الآن ...هذا الفرد (أو الخلية الحية) : له وعي بذاته .. وكذلك له وعي بمن بجواره مثله من الخلايا الحية الملاصقة له (أو الأفراد في هذا المثال) ولكن : بأي آلية وبأي تصور يمكنهم أن ينتظموا جميعا في تجمعات على شكل العبارة المطلوبة على أرض الملعب : مع العلم بأنه : لم يتم تدريبهم من قبل !!.. ولا يعرفوا الجملة - ذات المعنى - المطلوب منهم تكوينها سلفا !!!.. ولا ترابط (خارجي) بينهم !!!.. ولا مدرب يراهم كلهم من بعيد ويقوم بتوجيههم ووضعهم في أماكنهم الصحيحة (المطلوبة) للغرض (المطلوب) !!!.. فإذا استوعبت معضلات هذا المثال أستاذ هشام : فستجد أنها لا تساوي شيئا إذا ما قارناها بالتعقيد والتراكب الرهيب والتعاون (الخارجي) - من المفترض - بين الخلايا الحية في جسم الكائن الحي الواحد : لتسييره وإعطائه الكيان (الواحد) المميز له والذي له (معنى) !!!.. فلديك خلايا لحم وشعر وعضلات وليمف وعظام وغضاريف وكبد ومعدة وكليتين ورئتين ومخ - وأطراف وجسد لهم حدود خارجية مرسومة - ثم أوعية دموية وشبكة غاية في الدقة من المفترض أن تصل إلى كل ذلك وتغذيه !!.. ومثلها شبكة أعصاب تصل أيضا لكل ذلك لتتحكم فيه بنظامين : إرادي ولا إرادي إلخ إلخ إلخ !!!.. والسؤال الآن أستاذ هشام : أين هو (الوعي الذاتي) للخلايا بجانب كل هذه المعضلات التي تتطلب (وعيا كليا) ينظم كل ذلك وينظمه ويصممه ويربط بينه ؟؟.. أقول : بل حتى نحن كبشر أستاذ هشام - ورغم أن لنا وعيا وحرية وتصرف وتفكير مستقل - : إلا أننا وعلى المقياس الأكبر : نحتاج لنظام يجمعنا ويسيرنا في المدن !!!.. فكيف بجسم الكائن الحي المذهل ؟!!.. بل وكيف بداخل الخلية الحية الواحدة المعجز : من نواة لبروتينات وإنزيمات وميتوكندريا مصانع الطاقة والحمض النووي الوراثي إلخ إلخ إلخ ؟!!.. أوتعرف أستاذ هشام ...... دعني أفترض معك أن خلايا الجسم (المتفرقة بالمليارات) : قد وجدت طريقة ((ما)) للتواصل فيما بينها كالبشر تماما !!!.. وأنها استطاعت تكوين (وعي كلي) ينظم وينسق فيما بينها لينتج كيانا (واحدا) اسمه الإنسان مثلا له إرادة (واحدة) : وتكفيه الخلايا بطريقة (لا إرادية) وظائف جسده الحيوية الأخرى - عجيب ! - أقول : دعني أفترض معك أن الخلايا قد توصلت بطريقة ((ما)) إلى كل ذلك .. فهل لك أن تجيبني عن المثالين التاليين في المداخلة التالية أيضا : ولنغلق معا باب الحديث عن (وعي) الخلايا !!
    ---------------

    43...

    >>> أما المثال الأول أستاذ هشام : فسنأخذه من داخل جسم الإنسان .. حيث سأسألك سؤالين : السؤال الأول وهو : بأي آلية وبأي منطق يظهر نظام (قتل الخلايا) لتكوين الفراغات بين لحم الأصابع أثناء تكون الجنين !!.. ومثله قتل الخلايا المريضة ذاتيا !!!.. حيث يقوم الجين المنتحر - الجين P53 - بهذه الوظيفة للقضاء على الخلية وعلى نفسه معها حتى لا تؤذي غيرها !!!.. وأما السؤال الثاني - ولا زلنا في المثال الأول داخل جسم الإنسان - فهو بخصوص التكامل المعجز بين متطلبات التزاوج بين الرجل والمرأة !!!.. والتكامل الرهيب بين مواصفات الحيوانات المنوية المتكونة في خصية الرجل : وبين الرحلة الطويلة والمتنوعة التي تنتظرها في جسد المرأة !!!.. فنجد أن تفاصيل كل شيء قد تمت دراستها وعمل حسابها : رغم أن الحيوانات المنوية (((لا ترجع))) إلى خصية جسد الرجل مرة أخرى لتخبره بما حدث ؟؟؟.. وقد وضعت كلمة (((لا ترجع))) بين أقواس أستاذ هشام : للتنبيه على أنه حتى ولو افترضنا - جدلا فقط وتنزلا معك في الحجة - أن الخلايا لها وعي : تستغله في التصميم المعجز الذي نراه في كل شيء من حولنا : فالسؤال الآن هو : كيف عرفت الحيوانات المنوية في خصية الرجل كل التفصيلات ((الدقيقة)) التي ستقابلها في جسد المرأة وحتى تصل إلى البويضة ليلقحها حيوان منوي واحد ؟؟!!.. وما قيل عن الحيوان المنوي : يقال كذلك عن البويضة ولكن بصورة أخرى وهي : التدابير التي تم وضعها في البويضة لجذب الحيوانات المنوية إليها - وهي التي لا تعرفها أصلا ! - ولتحمي نفسها كذلك عند اختراق أول حيوان منوي لها : فتقوم بعكس شحنتها لتغلق أبوابها أمام أي اختراق لأي حيوان منوي آخر !!!.. < ملحوظة : يقع في نهاية غشاء ذيل الحيوان المنوي مستقبل خاص يسمى بـ CatSper : وهو عبارة عن قناة أيونية : هي التي تجذبه وتوجهه نحو هرمون شبيه بالبروجيسترون تفرزه البويضة > ...>>> وأما عن المثال الثاني أستاذ هشام للقضاء على قصة (وعي الخلايا) ومحاولة تعليق كل مظاهر التصميم الذكي بها : فهو مثال ننتقل فيه إلى خارج الإنسان .. حيث أعرض عليك فيه سؤالين وهما :السؤال الأول : قد رأينا مثالا لمدى تعقيد عملية التلقيح في الإنسان - ولم أتعرض للتعقيد والتكامل في الجماع وهرموناته وأعصابه وعضلاته والحمل وتغذية الجنين والولادة وانقباضاتها واتساع حوض الأم وعدم التحام عظام رأس الجنين وانتهاء بالرضاعة وظهور اللبن !! صدفة أو وعي !! - أقول : لما رأينا مدى التعقيد في هذا التلقيح في الإنسان : فقد يظن ظان أنه قد تطور هو الآخر (بالتدريج) من كائنات أبسط في الماضي !!.. أقول : بل هو أشد تعقيدا عند بعض هذه الكائنات الأبسط !!!.. ولنأخذ مثلا مسألةالانجذاب الكيميائي Chemotaxis للحيوانات المنوية للبويضة .. حيث سنستعرضه هذه المرة في كائن بسيط مثل حيوان Arbacia punctulata .. وهو حيوان مائي صغير الحجم - قطره 5 سم تقريبا - جسمه قشري كروي قوي : وتخرج منه زوائد .. وهو يعيش ملتصقا ًبالصخور .. وفي إناث هذا الحيوان - وراقب معي مقدار الوعي المطلوب هنا - : تقوم بوضع بويضاتها في الماء (أي التلقيح سيكون خارجي هذه المرة !!) ثم تقوم تلك البويضات بإفراز جزيئات هرمونية للجذب الكيميائي لمستقبلات ذيول الحيوانات المنوية !!!.. ولكن هذه المرة - وبوعي ! - تكون هذه الجزيئات الهرمونية من البويضة بتركيز عالي جدا ً: لأنها ستكون في الماء فتخففها !!!.. فمن أين عرفت هذه الخلايا بتخفيف الماء لها وهو خارج عنها !!!.. وبذلك كلما اقترب الحيوان المنوي من دائرة ذلك الإفراز : زاد انجذابه إليه وزادت دقته وسرعته !!!.. وهنا أنتقل للسؤال ثاني من المثال الثاني وهو : الطفيليات !!!!!.. تلك الهامة الشامخة التي تقصم كل تبريرات التطور بدءا من ادعاء (وعي) وتخطيط (ذاتيين) للخلايا الحية : وانتهاء بالطفرات والانتخاب الطبيعي إلخ إلخ !!.. وبداية أقول : كلمة طفيليات تعني : تلك الكائنات الحية التي تتطفل على غيرها وتحتاجه لاستمرار معيشتها وحياتها ... حيث نرى في دورة حياة طفيل البلهارسيا مثلا : أن البلهارسيا لا يمكن لها العيش والتكاثر : إلا باستكمال دورتها بين جسم الإنسان (أو العائل كما يسمونه) .. وبين المياه العذبة !!!... وأي تأخر أو اختلال هنا يعني هلاك البلهارسيا لقصر عمر بعض أطوارها كما سنرى بعد لحظات !!!!... وأنا بالطبع لن أ ُطيل وأ ُسهب في التفاصيل ولكني سأبرز فقط وباختصار : مدى تكامل كل طور من أطوار البلهارسيا وتوافقه التام بتغير شكل جسمه وصفاته حسب وضعه داخل الإنسان أو في المياه إلخ !!!!.. ليكون السؤال هو : كيف وأين ومتى تم تخطيط هذا التوافق والتكامل العجيب ؟!!!!... وذلك لأنه لو كان أول ظهور طفيل البلهارسيا هو في الماء (أي خارج جسم الإنسان) : فكيف عرف بتفاصيل جسم الإنسان التشريحية الدقيقة التي ستواجه حياته فيما بعد وسيتنقل بينها في أطواره وتغيرات جسمه ؟!!!!.. ومن الجهة الأخرى : لو كانت بداية ظهوره - فرضا ً- هي داخل جسم الإنسان : فكيف استطاع معرفة تفاصيل طريقة الخروج من جسم الإنسان عن طريق الاختراق إلى المثانة (البول) أو المستقيم (البراز) : فضلا ًعن معرفة ما سينتظره في العالم الخارجي مما يجب عليه أن يتكيف معه تماما ًفي حياته في المياه العذبة : وداخل أصداف وقواقع معينة ؟!!!.. هذه معضلات لا أرى لها حلا في (الوعي الذاتي) للخلايا أستاذ هشام !!!.. ودعني أنتقل معك لباقي أمثلتك ..
    التعديل الأخير تم 03-11-2013 الساعة 12:25 AM

  10. #10

    افتراضي


    مناظرة مع الملحد هشام آدم بعنوان : وجود الله ..
    الجزء 5 ...
    جرت هذه المناظرة في جروب (نقاش فكري) على الفيسبوك ..
    وقد انتهت بانسحاب الملحد بأعذار أني أخطأت ولفقت ودلست فيها .. ولله الحمد ..!
    ---------------

    44...

    >>> بالنسبة لادعاء تطور أحد أنواع السحالي - تسمى سحلية الحائط الإيطالية P. sicula - وهو الآكل للحشرات : إلى نوع آخر في 30 عاما آكل للنباتات أقول : تتلخص الخدعة هذه المرة في أنهم أتوا إلى نوعين مختلفين من السحالي - وبالاختلافات الجسمية والسلوكية التي ذكروها هم أنفسهم - : ثم كذبوا فقالوا بأن أحد النوعين : قد تطور إلى الآخر !!.. وقبل الشرح وبالتفصيل : فأود التنبيه على أن هناك أنواع من السحالي بالفعل تأكل (النباتات) !!.. فكما أن الطعام الأساسي للسحالي هو الأشياء اللينة والحشرات - وذلك لأن أغلب السحالي لها أسنان قصيرة تمسك بها الطعام ولكنها لا تقطعه - إلا أن منها ما يأكل النباتات والفواكه أيضا ً!!!.. وهذه المعلومة التي لا يعرفها الكثيرون نجدها في الموسوعات بكل بساطة مثل موقع almaoso3a أو حتى الويكيبديا عن السحالي حيث نقرأ من منتصف الصفحة تقريبا وتحت عنوان (Relationship with humans) أو علاقتها مع الإنسان .. نقرأ : Lizards are predominantly insectivorous, but some eat fruit, or vegetables. Live crickets and worms are the most typical foods for pet lizards .. والآن أستاذ هشام : تعالى نستعرض معا باختصار - ومن الويكيبديا - : قصة تطور هذه السحلية !!!.. حيث نقرأ أن هذه السحلية P. sicula قد تم في عام 1972م نقل عشرة منها بالغين : وذلك من جزيرة Pod Kopište إلى جزيرة Pod Mrčaru : والتي تبعد عنها فقط 3.5 كلم شرقا ًبكرواتيا .. ثم مع انتهاء الحروب اليوغوسلافية : عاد العلماء إلى الجزيرة الثانية : فماذا وجدوا بعد 35 سنة ؟؟؟.. - فقط ؟ وليس حتى ملايين السنين ولا ألافها ؟!! - لقد وجدوا نوعا مختلفا من السحالي !!!.. حيث يعتمد في أكله على النباتات وليس الحشرات : وعلى هذا صاحبته عدة تغيرات في جسده : سواء من الداخل لتوائم هضم النباتات : أو من الخارج !!!.. حيث صارت قوة العضة أقوى !!.. ومتوسط الحجم أكبر !!!.. وأطراف خلفية أقصر !!!.. ومتوسط سرعة عدو أو جري أبطأ !!!.. وتغير في الاستجابة لمهاجمة السكان !!!.. ووجود اختلاف في المصران الأعور لتبطيء مرور الطعام وتوفير غرف تخمير لكي تستطيع الميكروبات تحويل السيليلوز لهضم الطعام النباتي !!!.. وكذلك وجود ديدان خيطية في تلك السحالي : لم تكن موجودة لدى سحالي الجزيرة الأولى !!!.. انتهى الكلام ... أقول .. وللرد عليه : سأذكر أولا أن العلماء عندما رصدوا كل هذه الاختلافات : قاموا بعمل تحليل حمض نووي DNA لنوع السحلية في الجزيرة الأولى : والذي وجدوه في الجزيرة الثانية : فماذا وجدوا ؟؟.. وجدوا أنه شبيه به فقط ..؟!! أي مثلا كما تتشابه أنواع الكلاب المختلفة ؟؟!!.. وإليك النص بالإنجليزية : While mitochondrial DNA analyses have verified that P. sicula currently on Pod Mrčaru are genetically very similar to the Pod Kopište source population أقول : فإذا سلمنا بوقوع هذا الاختلاف الجيني بالفعل - وفي فترة قصيرة 35 سنة فقط - فذلك يهدم مزاعم التطوريين التي لجأوا إليها - وما زالوا - بتعليق شماعة التطور على الطفرات المتراكمة والمتراكبة لملايين وآلاف السنين !!.. وخصوصا : وأنهم بأنفسهم يعترفون بعدم تدخل الإنسان في تطور هذه السحلية المزعوم ولا حتى متابعته وتسجيله وملاحظته كأي فريق علمي محترم يتم اعتماد نتائجه وملاحظاته !!!.. and the P. sicula expanded for decades without human interference, .. وكل ذلك يعود بنا من جديد أستاذ هشام إلى دائرة (الافتراضات) التطورية التي لم يشاهدها أحد !!!.. والتي تجعل الأقرب للمنطقية هو أن السحالي في الجزيرة الثانية : هي نوع آخر وليست هي نفسها التي في الجزيرة الأولى !!!.. وإليك تأكيد آخر على ذلك أستاذ هشام وهو : أن صفات الجزيرتين أصلا ً: تكاد تكون متطابقة !!!!.. وعليه يكون السؤال هو : ما الذي أدى لتغير هذه السحالي في الجزيرة الثانية : وعدم تطور الأخرى التي في الجزيرة الأولى !!!!.. فالجزيرتان مثلا : هما في نفس الموقع من البحر الأدرياتيكي : ولا يفصلهما عن بعضهما البعض إلا 3.5 كم فقط !!!.. In 1971, ten adult P. sicula specimens from the island of Pod Kopište were transported 3.5 km east to the island of Pod Mrčaru (both Croatian islands lie in the Adriatic Sea near Lastovo) .. وأما الأكثر غرابة : فهو أن الجزيرتين لهما نفس : الحجم !!!.. والارتفاع !!!.. والمناخ المحلي !!!.. والغياب العام من الحيوانات المفترسة الأرضية !!!!... The two islands have similar size, elevation, microclimate, and a general absence of terrestrial predators ..! فهل اتضحت الصورة الآن أستاذ هشام ؟!!!.. وأخيرا ً: أن طريقة التطور بصورته التي أعلنوا عنها في هذه الحالة : والذي اعتمد على (تكيف) السحالي مع بيئة الجزيرة الثانية وطعامها إلخ - فلو صح - : لكان متناقضا مع القاعدة البيولوجية التي تقول : الصفات المكتسبة : لا تورث !!!.. حيث لو افترضنا أن أحد السحالي تأثر ببيئته من حوله (في حياته) وتكيف معها : فما هي الآلية التي نقل بها ذلك التكيف إلى ((جيناته)) وعمل ((شيفرات وراثية)) لها ؟!!!.. ثم : نقلها إلى أبنائه ؟؟!!.. إذا الخلاصة : إما أنهم يتحدثون عن نوعين مختلفين من السحالي !!.. وإما أن التغييرات المذكورة هي من قبيل (التكيف) في حياة كل سحلية تولد في هذه البيئة : ولا يتم توريثه وإنما يظهر ويزداد ظهوره مع كبر عمر الكائن - وذلك مثل الأشخاص الذين ينتقلون لمناطق شديدة البرودة أو الحرارة أو مرتفعة كثيرا عن سطح البحر acclimatization ..!
    ---------------

    45...
    >>> بالنسبة لمثالك أستاذ هشام عن الأفاعي المجلجلة : فهو مفيد بالفعل لكشف (الخلط) و(الافتراضات الزائدة) التي يروجها التطوريون على أنها من العلم : وهي ليست من العلم في شيء !!!.. أقول : أولا : أنت لم تقم بتعريف معنى (الغريزة) لنا !!!!.. وهل تلك الغريزة لها تمثيل جيني أم لا ؟!!.. ولو لم يكن لها : فكيف تدخل في حيز التطور ؟!.. ولو كان لها : فكيف يقوم الحيوان بترجمة (سلوك ما) قام به في حياته ووجده مفيدا : إلى مجموعة من الجينات والشيفرات الوراثية في خلاياه الحية ؟!!!.. عجيب صح ؟!.. ولنأخذ مثالا هنا وهو جلجلة ذيل تلك الأفاعي .. فنحن هنا أمام (((سلوك))) وليس (((صفة جسدية))) !!.. فهل يتم توارث ذلك السلوك في رأيك ؟!!.. المشاهد والمعروف عمليا هو : نعم !!!.. الكثير من الحيوانات والطيور والحشرات بل والطفيليات أيضا - وكما شرحت سابقا - إلخ تقوم بدورات حياتها ومختلف (تصرفاتها) (السلوكية) فيها بالغريزة والفطرة !!!.. والسؤال الآن : كيف تم ترجمة ذلك وراثيا وتحويله من (سلوك) خارجي (مثل الهجرة الموسمية في اتجاه معين لآلاف الأميال) : إلى معلومات ممثلة على الحمض الوراثي ؟!!.. لدرجة أن الأبناء يولدون بكامل معلوماتهم اللازمة لهم في الحياة التي لم يتعرفوا عليها بعد !!!.. حسنا .. نعود للأفاعي المجلجلة التي اكتشفت أن صوت ذيولها جلب عليها الهلاك : فقررت أن توقفه .. ودعنا الآن أستاذ هشام نحاول رسم ((سيناريو)) لما سيحدث .. فهذا الجيل في هذه المنطقة : سيتوقف عن جلجلة ذيوله .. فهل سيتأثر بذلك الجيل الذي بعده ؟!!.. لا !!!!.. لأن الصفات المكتسبة - ودعنا نقول والمفقودة - لا تورث !!!.. ثم كل جيل يولد : سيعلمه أبواه أن لا يجلجل بذيله حتى لا يهلك .. وهكذا إلى آلاف أو ملايين السنين .. السؤال الآن أستاذ هشام هو : هل ((عدم استخدام)) الأفاعي لذيولها : سيتم ترجمته ((جينيا)) إلى أوامر تقتضي بالتخلص من الذيول المجلجلة ؟!!!.. وإذا فرضنا - جدلا فقط - أنه حدث : فمن الذي سيقوم بهذه المهمة الصعبة ؟؟؟.. ((ملاحظة - تقييم - أخذ قرار - قدرة على التشفير - قدرة على التعديل - قدرة على حماية الوضع الجديد)) ؟!!.. مَن ؟؟؟؟.. أقول : ألا تلاحظ معي أستاذ هشام أنه لو صح فهمنا لكلامك : أنك تكون قد عدت بذلك لأكثر من قرن ونصف من الزمان إلى نظرية ((الاستخدام وعدم الاستخدام)) التي قال بها لامارك : وتأثر بها داروين في فرضياته وكتابه أصل الأنواع ؟!!.. حيث يقول في الباب الأول من كتابه وتحت اسم : التمايز تحت تأثير التدجين Variation under demostication وتحت العنوان الثاني من الباب وهو تأثيرات السلوك Efficts of Habits ومن أول سطر : " السلوكيات التي تتغير : تحدث تأثيرا وراثيا !!.. ومثال ذلك ما يحدث في الفترة التي تزهر فيها النباتات عندما تنقل من مناخ إلى مناخ آخر : أما في الحيوانات فإن الزيادة في استخدام أو عدم استخدام الأجزاء قد كان له تأثير أكثر وضوحا " !!.. ولعل بعض المعجبين بداروين والتطور - وخصوصا من العرب - لم يكونوا يعرفون ذلك عنه .. ولكن مع ترجمة كتابه للغة العربية : ظهرت الفواجع للأسف فقط : لمَن قرأه !!!.. - ومن هنا أنا أستبشر خيرا بترجمتك لكتاب جيري كوين : لماذا التطور حقيقة ؟ Why Evolution is True - أقول .. هذا واحد من عشرات السقطات العلمية التي نص عليها داروين في كتابه بوضوح وتأثر بها لعشرات السنوات مَن أتوا بعده - وإلى اليوم - !!.. هذا عما بقي في كتابه .. وأما مثال آخر لما تم حذفه لمبالغته فيه في خياله التطوري : فكان مثال تطور الدب إلى حوت !!!!!!!!!!!!.. نتيجة لـ (سلوكه المائي) !!!.. حيث قال في صفحة 184 - والتي تم حذفها لاحقا - : وتعليقا على مشاهدة صديقه هيرني للدب الأسود وهو يعوم لساعات في أمريكا الشمالية فاتحا فمه ليصطاد الحشرات مثلما يفعل الحوت مع الأسماك : فقال داروين - تقريبا أخذها بالشبه كده - : " أنه لا يجد أي صعوبة في تخيل نوع من الدببة : وبمزيد من السلوكيات البحرية في حياتها : ومزيد من اتساع فمها ومع الانتخاب الطبيعي : أن تصبح يوما ما مخلوقا في حجم الحوت الضخم " !!!.. والنص بالإنجلزية : In North America the black bear was seen by Hearne swimming for hours with widely open mouth, thus catching, like a whale, insects in the water. Even in so extreme a case as this, if the supply of insects were constant, and if better adapted competitors did not already exist in the country, I can see no difficulty in a race of bears being rendered, by natural selection, more and more aquatic in their structure and habits, with larger and larger mouths, till a creature was produced as monstrous as a whale. ..! المصدر - Charles Darwin, The Origin of Species: A Facsimile of the First Edition, Harvard University Press, 1964, p.184 .. ولكني سأحسن الظن بك أستاذ هشام وأقول أنك ربما تعني أنه : ربما في فترة آلاف السنين القادمة : ظهرت طفرة تسبب عدم جلجلة إحدى الأفاعي لذيلها .. وعلى هذا يكون السيناريو هو : أنه مع الوقت ومع الانتخاب الطبيعي وتميز هذه الأفعى عن غيرها بقدرتها على البقاء : سيتم اصطفاؤها دونا عن غيرها لتسود ..! وهنا أقول : وهل هذا ما سيقع بالفعل أستاذ هشام ؟!!.. أم أن الواقع يقول أنها لن تتمايز عن غيرها لأن كل الأفاعي من حولها أيضا لا يجلجلون ذيولهم أصلا ولكن سلوكا : لا ولادة !!!.. ما الجديد ؟!!.. وما المميز ؟!!.. أترك لك الإجابة على كل هذه الأسئلة .. لنتابع ...
    ---------------

    46...
    >>> أقول .. ومن هنا يمكنني استعراض تعريفك ((الأكثر تفصيلا)) عن التطور أستاذ هشام .. والذي نقلته لنا من كلام أحد أبرز التطوريين وهو دوغلاس جويل فوتويما Douglas Joel Futuyma حيث يقول : "" في المفهوم العام للتطور فإنَّ التطوّر هو تغير ليس إلا. وكل شيء في هذا الكون خاضع للتطور (التغير) بدون أيّ استثناء، المجرات والنجوم، لغة البشر، الأنظمة السياسية... كلها تتطور بشكل أو بآخر، ولا شيء ثابت في هذا الكون. وتعريف التطور البيولوجي هو: التغير في خصائص الجماعات الحاصل حتمًا في فترة تفوق فترة حياة أحد أعضاء تلك الجماعة. والتغيرات في خصائص أفراد الجماعات بمعزل عن مجموعاتها لا تعتبر تطوراً لأنَّ المنظمات الحيوية الفردية لا تتطور بمعزل عن جماعاتها. إنَّ التغيرات التي تعتبر تطورًا هي التغيرات التي يتم توريثها من أجيال سابقة عن طريق المادة الجينية. والتطوّر البيولوجي قد يكون طفيفًا أو أساسيًا، فهو يشمل تغييرات الجينات التي تحدد زمرة الدم في الجماعة الواحدة ويشمل أيضا التغييرات التي أدت إلى نشوء أحياء معقدة كالحلزون والنحل والزرافات من كائنات عضوية أكثر بدائية."" أقول : هنا لي ثلاثة تعليقات .. 1- توسيع مفهوم التطور (عمدا) ليشمل أي تغيير ! حتى أنه لم يربطه ولو مرة واحدة في كلامه أن يكون نافعا ! وذلك لأن الكثير من الأمراض التي تصيب الكائنات الحية هي في أصلها وحقيقتها : تغيير جيني أيضا ! 2- من الجيد جدا أنه ذكر في آخر كلامه (التطور الكبير) أو (الحقيقي) الذي يعرف أن الجدال ينصب أصلا عليه لأنه هو ظهور حيوان لم يكن لو وجود من قبل .. وضرب مثلا بذلك : الحلزون والنحل والزرافات ! أقول : إلى اليوم أستاذ هشام وما زال يتخبط التطوريون في تفسير كيفية ظهور وتطور عشرات الكائنات الحية وتحديد أسلافها أو تصنيفها الشجري ! والناظر في كلام التطوريين في ذلك يرى مدى (السطحية) التي يفترضون بها مثل هذا التطور الكبير ! والذي لا يعتمد في أغلبه إلا على الشبه الخارجي والتشريح الظاهري ! ثم تأتي الجينات لتكذب كل ذلك وتصطدم التطوريين بالغرائب تلو الغرائب ! فقد رأينا داروين مثلا وهو يفترض تطور الدب : إلى حوت يكبره بمئات المرات في الحجم والوزن ! ويختلف عنه بدرجة كبيرة في التشريح والتنفس والولادة والرضاعة تحت الماء وتحديد الاتجاهات والأغشية الحافظة للتنفس والزعانف ومقاومة الضغط إلخ إلخ .. وهناك آخرون قد فسروا خرطوم الفيل بأن تمساحا قام بمسكه من أنفه القصير - قبل التطور - فطال أنفه من ساعتها ! وهناك من لا يرى أي إشكالية في خروج الأسماك من الماء بالطفرات البطيئة والانتخاب الطبيعي : ونسي (أو تناسى) أن هناك تعقيدا حيويا يقف أمام هذه الخرافة وليس بالسطحية التي يصورونها للعوام ! حيث يجب ظهور أكثر من تعقيد في جسم السمكة : وفي وقت واحد : حتى تستطيع الخروج من الماء وتعيش ! فتحتاج لتغيير في جهازها التنفسي ! والعظمي ! والعضلي ! والإخراجي - بما فيه التعرق - ! وهناك من كان يرى أن الباندا الأبيض (الكبير) والباندا الأحمر (الصغير) لهما نفس السلف المشترك للتشابه الظاهري الكبير بينهما (أي أن كلاهما من الدببة) : حتى أن الباندا الأبيض لديه إبهام إضافي في يده أي ستة أصابع : وكذلك الباندا الأحمر .. ولكن مع اختبارات الحمض النووي الوراثي لهما : ظهرت النتيجة وهي أن الباندا الأبيض الكبير ينتمي لفصيلة الدببة : وأما الباندا الأحمر الصغير فينتمي لفصيلة الراكون ! وكذلك أيضا التشابه الظاهري بين حيواني الفقمة : وأسد البحر .. فقالوا أن لهما أصل مشترك بالتأكيد .. ولكن المفاجآت بعد ذلك توالت عليهم في دراساتهم للحيوانين : لدرجة أن وصل الحال بهم إلى أن قالوا أن الفقمة قد تطورت من الظربان ! وأما أسد البحر فقد تطور من كلب أو دب ! وهكذا العجائب تتوالى والتخبط يتزايد .. فنرى خلد الماء يحتارون في نسبته وقد أعجزهم خلق الله تعالى المعجز له ليجمع بين سمات العديد من الحيوانات (طيور - ثدييات - أسماك) ! وأيضا أرنب الصخور : وهو حيوان ثديي كثيف الشعر : واختلفوا في تحديد سلفه الأعلى ! فأسنانه تشبه أسنان الفيل ! ولكن أذناه تشبه أذنا الحصان ! وأما المضحك المبكي أستاذ هشام : فهو - وكما تسخر دوما من فكرة الخالق وتراها غير منطقية - فلتقارنها لنا إذا ًبأفكار التطوريين عندما يبدعون في تفسيرات (التطور الكبير) بأعاجيب القصص والخرافات (اللا علمية حتى) : وإلى اليوم : وإلى وقت قريب !!!.. ولعلي هنا أحب قصة تفسيرهم لظهور ((اللبن)) في الثدييات ! فهي إحدى المعضلات أيضا التي ليس لها حل إلا الخالق عز وجل ولكنهم يتكبرون ! نجدهم يقولون : " شرعت بعض الزواحف التي عاشت في المناطق الباردة : في تطوير أسلوب للحفاظ على حرارة جسمها !!.. وكانت حرارتها ترتفع في الجو البارد ! وانخفض مستوى الفقد الحراري عندما أصبحت القشور التي تغطي جسمها أقل ! ثم تحولت إلى فرو ! وكان إفراز العرق وسيلة أخرى لتنظيم درجة حرارة الجسم ! وهي وسيلة لتبريد الجسم عند الضرورة عن طريق تبخر المياه !!.. وحدث بالصدفة (!) : أن صغار هذه الزواحف بدأت تلعق عرق الأم لترطيب نفسها !!.. وبدأت بعض الغدد في إفراز عرق أكثر كثافة (!) تحول في النهاية إلى لبن (!) ولذلك حظي هؤلاء الصغار ببداية أفضل لحياتهم " ! المصدر - National Geographic, vol. 50, December 1976, p. 752. George Gamow, Martynas Ycas, Mr Tompkins Inside Himself, London: Allen & Unwin, 1968, p. 149 .. وأما تعليقي الثالث والأخير على دوغلاس فوتويما للتطور : فأتركه للمداخلة القادمة
    ---------------

    47...
    3- وأما التعليق الثالث والأخير على تعريف دوغلاس فوتويما للتطور : فأتساءل معه : ما الذي دفع الرجل - وهو من أعلام لتطور - لتوسيع دائرة التطور ليشمل ((كل تغيير)) ولو طفيف في الكائنات الحية ؟!!.. بما في ذلك التكيف والتأقلم والتغييرات (الوقتية) الذين ذكرتهم في كلامي من قبل !!!.. (مثل تغير قدرة الإنسان على التنفس في المناطق المرتفعة وتأقلمه بعد فترة معها !!.. أو تأقلمه في المناطق الباردة أو الحارة في التعرق ومسارات الدم تحت الجلد !!.. بل وحتى صار مجرد تغيير لون البشرة تبعا لقوة أو ضعف الأشعة الشمسية تطور !!.. وكذلك قوة عضلات اليدين أو الفك حسب المجهود أو العمل أو الرياضة أو أنواع الأكل !!!.. إلخ) .. أقول : الرجل قام بتوسيع مفهوم التطور لكل هذه الدرجة : ليحفظ ماء الوجه عندما ((لا يجد)) أدلة على التطور الأكبر ليتحدث عنها : فيصير بإمكانه التحدث عن التطور الأصغر (بدلا منها) !!!.. وأما السبب : فهو أن الرجل - وبخلاف ما أخبرنا به الأستاذ هشام من تهافت فكرة الخلق المباشر وأن العلماء تركوها كفرضية منذ زمن - أقول الرجل : يقر ويعترف أنه إذا استمر الظهور المفاجيء في الحفريات للكائنات الحية وهي في كامل تطورها وكما نعرفها إلى اليوم بعد مئات الملايين من السنين : واستمر في المقابل الغياب (الدائم) للحفريات الوسطية التي نسف غيابها كل فرضيات الانتخاب الطبيعي والتطور البطيء بالطفرات - من المفترض - !!.. فإنه لا مناص حينئذ من الاعتراف بالخلق المباشر - لاحظوا أنه يعترف أنها فرضية مطروحة توصل إليها حتما وعقلا ومنطقا - حيث يقول - وبكل وضوح - : " إما أن تكون الكائنات الحية قد ظهرت على وجه الأرض وهي كاملة التطور : وإما أنها لم تظهر ..!! وإذا لم تكن قد ظهرت في شكل كامل التطور : فلابد أنها قد تطورت من أنواع كانت موجودة من قبل عن طريق عملية تحور ما .. وإذا كانت قد ظهرت في شكل كامل التطور : فلا بد أنها قد خُلقت بالفعل بواسطة قوة قادرة على كل شيء " !!.. المصدر - Douglas J. Futuyma, Science on Trial, New York: Pantheon Books, 1983, p. 197 .. أقول : هذا الكلام عن احتمالية الخلق المباشر عندما يصدر من عالم (تطوري) يا أستاذ هشام : فهو يؤكد أن قضية الخالق المباشر هي قضية ((ما زالت)) مطروحة إذا صحت شواهدها !!!.. وشواهدها إلى اللحظة - ومنذ بدء الإنسانية وإلى نهايتها - صحيحة بالفعل !!!.. أنواع تظهر فجأة في السجل الحفري بدون مقدمات وبكامل تعقيداتها !!!.. ثبات على مدى ملايين ومئات الملايين من السنين لم تتغير عما نعرفه اليوم !!!.. الأمر لا يحتاج لكثير تفكير أستاذ هشام .. وحتى بالمنطق : فإذا سألتك مَن هو رئيس دولة إستونيا : هل هو باراك أوباما ؟؟.. أم توماس هندريك إلفيس ؟؟.. وكنت أنت على يقين بأن باراك أوباما هو رئيس أمريكا لا غيرها : فيمكنك ساعتها اختيار توماس هندريك إلفيس وأنت على يقين بصحة إجابتك : رغم أنك لم تكن تعرفها من قبل !!!.. وهذه هي القضية بكل بساطة أستاذ هشام !!.. الخلق المباشر ليس خيالا وافتراضا لا صحة له ولا وزن .. بل هو في نظر المؤمنين قائم بأدلته الذاتية التي لا ينكرها إلا جاحد .. أما عند غير المؤمنين من المتشككين ونحوه : ففي أقل حالاته هو أحد التفسيرات المطروحة (تفسير من بين اثنين لا ثالث لهما) لوجود الكائنات الحية بكل تمايزها وتنوعها إذا لم يصح التدليل على وجودها بالتطور - وهذا هو الواقع إلى الآن ودعك من البروباجندا - ..! وأما بالعودة لكلام دوغلاس فوتويما مرة أخرى وعدم استبعاده للخلق المباشر - ولاحظ أنه كلام حديث نسبيا - أقول : فهو يذكرني بكلام قديم مشابه - ولكنه أكثر وضوحا وعقلانية - لألفريد والاس نفسه Alfred Russel Wallace : والذي أخذ منه داروين فكرة الانتخاب الطبيعي !!!.. وهذا دليل آخر على ((عجز)) الانتخاب الطبيعي عن تفسير بعض معضلات فرضيات التطور : حتى ولو بالخيال - والخيال هو كل رأس مال فرضيات التطور إلى اليوم - ! فوالاس كان يؤمن بقوة روحية عليا في الكون : هدفها - أو أقصى غاياتها كما ظهر له - هو خلق الروح الإنسانية !!!.. فظهور الإدراك الإنساني هو أحد ثلاث معضلات : كان الرجل صادقا مع نفسه عندما (((استثناهم))) من خرافة الانتخاب الطبيعي !!.. حيث يؤمن بالتدخل ((المعجز)) لهذه القوة الروحية العليا في الكون ثلاث مرات على الأقل في تاريخ الحياة : 1- إنشاء الحياة من مواد غير عضوية ..!! 2- منح بدايات الوعي للحيوانات العليا ..!! 3- إخراج البشر في صورة المالك للإدراك الكلي ..!! والنص بالإنجليزية من صفحة الويكيبديا الخاصة به : something in "the unseen universe of Spirit" had interceded at least three times in history. The first was the creation of life from inorganic matter. The second was the introduction of consciousness in the higher animals. And the third was the generation of the higher mental faculties in mankind. He also believed that the raison d'être of the universe was the development of the human spirit ..! إذا أستاذ هشام : القول بخالق مباشر للكائنات الحية : ليس بالدرجة التي ذكرتها من الرفض والاستنكار والاستبعاد العلمي والمنطقي !!!.. بل ومن النقل السابق لوالاس : أنتقل بك للتعليق على أخطاء التصميم الذكي وتطور الإنسان !
    ---------------

    48...
    الإنسان ....! ذلك المكرم في الأديان : المهمش في التطور والإلحاد !!!.. رغم أن الكون كله والحياة على الأرض دلت الكثير من العلماء أنهم لن يكونوا كذابين إذا قالوا أنه هو (السبب) الذي من أجله خلق الكون !!!.. سواء من أجله ماديا وانصباب الكل في خدمة حياته على هذه الأرض .. أو عقليا روحيا !!.. وكل ذلك تبلور في مباديء الأنثروبي اليوم !!.. ولعل من أفضل الكتب التي يمكنك القراءة عن ذلك فيها جيدا : وأدلته العلمية على الأقل - ودعنا من العقلية والروحية الآن - فهو كتاب الدكتور مايكل دانتون Michael Denton الشهير : قدر الطبيعة : كيف كشفت قوانين البيولوجيا الغرض من الكون !!.. Nature's Destiny. How the Laws of Biology reveal Purpose in the Universe .. وأما بالعودة للمعضلة (العقلية الإدراكية) الخاصة بالإنسان وتميزه : والتي تنكرها أنت بغرابة شديدة أستاذ هشام بقولك : "" نأتي الآن للأهم: هل الإنسان بعيد عن التطوّر؟ علميًا يُصنف الإنسان (ويا للغرابة!) ضمن مملكة الحيوان، وهذا يعني أننا "علميًا" مصنفون على أننا حيوانات، فهل هذا التصنيف جاء اعتباطًا؟ على أنَّ هذا ليس هو الحجّة الوحيدة المتوفرة على أنَّ الإنسان لا يختلف عن بقية الكائنات الحيّة فيما يتعلق بالتطوّر، فنحن، كغيرنا من الكائنات، تسيري علينا قوانين الطبيعة العمياء والتي تتعامل بحياد كامل تجاه الكائنات، وتميّز بين كائن وآخر، ولكن ثمّة أمر يجد أن أتطرق إليه قبل أن أغوض أكثر في هذا الموضوع، فإننا نلاحظ أنَّ الإنسان ككائن مُدلل عن الآلهات (أو مُكرّم) يفتقر إلى كثير من الصفات التي تتمتع بها كائنات أخرى "" أقول : العجيب أستاذ هشام أنه حتى داروين نفسه - ومثل ألفريد والاس - قد اعترف بذلك التميز المعجز للإنسان ولكن على استحياء كعادته !!.. ثم صاغه متهربا بكلام لا يسمن ولا يغني من جوع - وهو أسلوبه مع كل معضلات فرضياته في كتابه - حيث قال : " وأخيرا .. فإن أكثر من كاتب قد تساءل : لماذا حدث ارتقاء في القدرات العقلية لبعض الحيوانات : أكثر مما حدث لغيرها .. حيث إن مثل هذا التقدم كان من شأنه أن يكون ميزة كبيرة للجميع ؟!.. ولماذا لم تمتلك القرود : القدرات العقلية التي يتمتع بها الإنسان ؟!!.. وللرد على هذه التساؤلات : فإن أسبابا مختلفة من الممكن أن تقدم .. ولكن بما أنها أسباب (أفتراضية) !!.. وبما أنه لا يمكن وزن احتمالاتها النسبية : فإنه لا توجد فائدة ترجى من تقديمها !!.. ووجود رد (قاطع) للسؤال الأخير : يجب ألا يتوقعه أحد " !!!.. أقول : هذا الكلام أستاذ هشام : يترجم لنا الحيرة (الحقيقية) التي انغمس فيها التطوريون والملاحدة عند النظر لتميز الإنسان بين كل الكائنات الحية المعروفة !!!.. ومن هنا أستاذ هشام - ومن هذا المنطلق - أبدأ في تناول الرد على أدلتك (التطورية) على السلف المشترك للإنسان والشيمبانزي أو القرود !!..

    ***

    هشام آدم :
    أخيرًا أقول: إنها فرصة سعيدة أن أتناقش معك، وكنتُ أتمنى أن تتوفر لدينا نحن الاثنين الشجاعة والموضوعية الكافيتين لنخوض في نقاش كهذا، ولكن وحيث أنَّ الأمر لم يكن على النحو المرجو في هذا النقاش، وحيث أنَّك تتعمَّد التفليق، وهو تمامًا ما يقوم به الكثيرون فقط للانتصار لفكرتهم، وهو أمر محزن فعلًا، فإنني أنسحب من النقاش، وأتمنى فقط منك ومن كل شخص تابع هذا النقاش أن ينظر إلى الأمر بتجرّد وبموضوعية، فالعلم والعلماء لا يبحثون أصلًا حول موضوع (هل الله موجود أم غير موجود) وليست لديهم أهداف إلحادية كما يتخيّل للبعض، ولكن ببساطة شديدة، العلم (أو كثير من الاكتشافات العلمية) لها نتائج إلحادية، فكلّما تطوّر العلم كلما ابتعد الإنسان أكثر فأكثر عن تلك الفكرة الخرافية، وكلما زاد يقينه بأنَّه ليس كائنًا مميزًا على الإطلاق. إنه لأمر محزن فعلًا أن نكتشف ذلك، ولكن العلم لا يعترف بالعواطف، ولا يكترث لها، وليست وظيفة العلم أن يهبنا الشعور بالرضا. نظرية التطوّر أقوى بكثير من أن تدحضها خرافات الخلقيين، وحتى لو افترضنا جدلَا أنَّ العلم تمكن من إثبات وجود خالق أو مصمم ذكي، فبالتأكيد لن يكون هو أحد الآلهات الدينية الرئيسة المعروفة (اليهودية – المسيحية – الإسلام)، وهذا ما أنا متأكد منه، ولا أتشكك حوله أبدًا، فقد بدى الأمر واضحًا بالنسبة إليّ، وفي كل مرة تزداد قناعتي بهذا الأمر. وصدقني عزيزي أبوحب، أحترم لكَ ولكل المتدينين إيمانهم وعقيدتهم، ولكن عندما يكون الأمر نقاشًا علميًا، فليس هنالك مجال أبدًا للمجاملات. فقط كن أمينًا مع نفسك، ومع الآخرين، ولا تحاول أن تخدعهم بنقل الأكاذيب والتلفيقات التي نقرأها هنا وهنالك على الإنترنت، فأنتَ مسؤول تمامًا عن أيّ فكرة تترسخ في أذهان الآخرين بسبب هذا التصرف غير المسؤول وغير الأمين. أشكرك على هذا الوقت الممتع، وأشكر مدراء المناظرة على حيادهم، وأشكر الأخ والصديق عبد الدائم نوري على استضافته لي، ويحق لك أن ترد على ما جاء في مداخلاتي طبعًا، ولكن فقط يؤسفني أنني لن أتمكن من الاطلاع عليها، لأنني سوف أغادر هذا الجروب بعد نشر هذه المداخلات مباشرة. كن بخير.
    ---------------

    49...
    حسنا أستاذ هشام .. قرأت كلامك الأخير .. وبالفعل الأمر متروك للقاريء في النهاية ليقرأ ويقيم - وخصوصا وأن فضاء النت مفتوح لتتبع كلامي وكلامك - وأعترف أنك كنت مهذبا في المناظرة وهو شيء جيد - بل هو رئيسي في استمرارها كل ذلك الوقت - وأحترم رغبتك بالطبع في الانسحاب .. وإن كنت لا زلت أحتفظ لنفسي بحق الرد .. وسوف أبدأ في كتابة مداخلات ردودي بعد قليل .. وصدقني : أدعو الله تعالى لك بالهداية .. فهي لها أسباب كثيرة جدا لا تتخيلها .. لعل أن يصيبك أحدها يوما .. وأما بالنسبة لقدرتك على الترجمة .. فاعلم يا هداك الله أن ما تكتبه يداك اليوم من ترجمة عن الإلحاد والتطور : هو أكبر خدمة للمسلمين ولله الحمد .. فكتب التطوريين والملاحدة تولد في الغرب ومعها رهبتها والهالة القدسية التي يلبسونها لها لخداع العوام والبسطاء وغير المتخصصين في الخارج - ثم تنتقل بنفس رهبتها وهالتها إلى ضحايانا العرب والمسلمين : وتظل هكذا ينظر إليها وكأنها أقصى ما وصل إليه العلم والحقائق : إلى أن يقوم بترجمتها أحد !!!!.. - وكما وقع مع كتاب أصل الأنواع لداروين - عندها : يصير من السهل كثيرا - وللقاريء العربي العادي حتى - أن ينتقدها ويظهر عوار أفكارها بعد أن ذللها الله تعالى له وساق مادتها إليه بلغته !!!.. على العموم .. وكما تعتز أنت كثيرا بمجموعة من كتب التطور وتراها ((كافية)) للإقناع - من وجهة نظرك ونظر الملاحدة والتطوريين - .. فنحن كذلك نحترم مجموعة كبيرة من الكتب ((العلمية)) في الخارج : والتي تدحض تماما أفكار الصدفة والعشوائية في الخلق وتهدمها من جذورها بالأرقام والدراسات والإحصائيات والمنطق والمشاهدة !!!.. فهناك كتاب : هناك إله !!.. وهو عن الملحد السابق أنتوني فلو ((والذي قضى أكثر من 60 عام داعيا للإلحاد)) !!!.. والذي كان من أسباب إيمانه بوجود قوة خالقة عاقلة أخيرا هو إعجازات الخلية الحية والحمض النووي المذهل - والتي تفوق بكثير حقيقة أن الخلايا لها وعي ! - إلى وجود عقل وتدبير وتصميم وتشفير وحرية اختيار وإرادة !!.. وهي الأشياء التي تفتقدها الجزيئات والذرات أستاذ هشام - وأخبرتك بهذا مرارا وتكرارا ولكنك تصر على بتر كلامي : There Is a God : How The world's most notorious atheist change his mind - Antony Flew .. وهناك أيضا كتاب فرانسيس كولين : لغة الإله : وهو عن الأدلة ((العلمية)) الدامغة على وجود إله : The language of God: A scientist presents evidence for belief - By Francis S. Collins .. وهناك كتاب آخر هام وهو للكاتب جيري بيرجمان بعنوان : كيف يعلم التاريخ التطوري احتقار المرأة ؟! - هذا يناقش جانبا آخرا مظلما من نظرية التطور قلما يثيره أحد المؤمنين بها !!.. وصدقني أستاذ هشام : لن تكون سعيدا أبدا إذا قرأه أحد عن نظرة داروين والتطور للمرأة !! The History of Evolution's Teaching of Women's inferiority - Jerry Bergman .. وبالطبع كتاب ديفيد برلنسكي - والذي وصفته أنت بأنه لاهوتي .. ووصفته كذلك بأنه لا أدري !!.. فصرت أنا الذي لا أدري ماذا تدري عنه أستاذ هشام ؟!! - وكتابه شهير بالطبع وهو : وهم الشيطان : الإلحاد وأدلته العلمية The Devil's Delusion : Atheism and its Scientific Pretensions - David Berlinski .. وهناك كتاب آخر لأخينا الدكتور أبي الفداء ابن مسعود من منتدى التوحيد والألوكة للرد على كتاب وهم الإله لريتشارد داوكينز .. والكتاب باسم : هدم أسس الإلحاد Blasting the foundations of athisme. It's pseudo science and pseudo raison . Ansewring Richard Dawkins. The God delusion - AbulFeda - وللعلم : قد صدر له كتاب آخر ولكن باللغة العربية في معرض الكتاب الماضي باسم " آلة الموحدين لكشف خرافات الطبيعيين " وهو مفيد جدا جدا للمتخصصين في العلوم الحديثة وفلسفتها .. وهناك كتاب تيومير ديميتروف عن أشهر 50 عالم فائزين بجائزة نوبل مؤمنين بالله : 50 Nobel Laureates and other great sceintists who blieve in God - Tihomir Dimitrov .. وأما الكتاب الأكثر من رائع : هو كتاب ستيفن ماير : التوقيع في الخلية !!.. وهو عن أدلة الحمض النووي على التصميم الذكي Signature in the Cell: DNA and the Evident for intelligent Design - Stephen C. Meyer .. وهناك أيضا كتاب جوناثان ويلز : أيقونات التطور - علم أم خرافة ؟؟!!.. لماذا ما نتعلمه عن الكثير من التطور هو خطأ ؟ Icons of Evolution: Science or myth ! Why much of what we teach about evolution is wrong - Jonathan Wells .. وكذلك كتاب مايكل بيهي : الصندوق الأسود لداروين - تحدي البيوكيميا للتطور !! Darwin’s Black Box: The Biochemical Challenge to Evolution (Michael J. Behe .. وأخيرا- وحتى لا أطيل - : كتاب قدر الطبيعة لمايكل دانتون : كيف كشفت قوانين البيولوجيا عن الغرض من الكون ؟ Nature's Destiny: How the Laws of Biology Reveal Purpose in the Universe - Michael Denton .. فكل هذه الكتب تنتظر من يترجمها للجمهور ((المسلم)) أستاذ هشام .. ولعلك تكون منهم قريبا إن شاء الله .. والآن مع الردود التي تأخرت ..
    ---------------

    50...
    >>> قبل كل شيء .. فأنوه إلى أني نسيت ذكر المرجع للكلام الذي نقلته كتابة عن داروين من أصل الأنواع : ألا وهو الصفحة 359 من النسخة العربية - ترجمة مجدي محمود المليجي 2004م والتي قال فيها داروين : " وأخيرا .. فإن أكثر من كاتب قد تساءل : لماذا حدث ارتقاء في القدرات العقلية لبعض الحيوانات : أكثر مما حدث لغيرها .. حيث إن مثل هذا التقدم كان من شأنه أن يكون ميزة كبيرة للجميع ؟!.. ولماذا لم تمتلك القرود : القدرات العقلية التي يتمتع بها الإنسان ؟!!.. وللرد على هذه التساؤلات : فإن أسبابا مختلفة من الممكن أن تقدم .. ولكن بما أنها أسباب (أفتراضية) !!.. وبما أنه لا يمكن وزن احتمالاتها النسبية : فإنه لا توجد فائدة ترجى من تقديمها !!.. ووجود رد (قاطع) للسؤال الأخير : يجب ألا يتوقعه أحد " !!!.. >>> ولأن رفع الملام مقدم على جلب الشكر أو المدح - فأحب أن أشير إلى أخطاء تقولها عليّ الأستاذ هشام للأسف وليست من الصحة في شيء .. ## الأول : قوله أني أنكر ((وعي)) الخلية الذاتي .. وتناسى أني أثبت لها وعيا ذاتيا ((بل وذكرت له من القرآن آية تسبيح كل شيء لله !!)) ولكن ما أنكرته هو إقحام ((عقل وذكاء وحرية إرادة واختيار وقدرة على الإبداع والتصميم)) لها !!.. واستدللت على نقض ذلك بأن أصغر مكونات الخلية وهي الذرات والجزيئات المكونة للبروتينات والحمض النووي إلخ إلخ : نراها مطيعة تماما في المعامل تحت يد الإنسان : ولا تتغير استجابتها وسلوكها أبدا !!.. وهو ما لم يتعرض للرد عليه الأستاذ هشام من قريب ولا بعيد !!!.. ## الثاني : وهو ادعاؤه أني متناقض في القول مرة بظهور الكون من لا شيء : صدفة !!.. ومرة بفعل فاعل (أو خالق) !!.. وأقول : بالله عليك يا أستاذ هشام : هل هناك واحد مسلم - فضلا عن محاور لسنوات وفي منتدى التوحيد - ستجده يقول أن الكون ظهر صدفة ؟؟!!!!!!!.. فإذا كانت هذه هي حدود فهمك من كلامي أستاذ هشام : وعدم مقدرتك على التفريق بين أسلوب مجاراتك (جدلا) لإقامة الحجة عليك : وبين ما أدين الله تعالى به وذكرته لك : فلا عجب أن تحدث أكثر من فجوة بيننا في الفهم - وعلى الهامش : لماذا تريد أن تلزمني بـ ( كل ) أقوال الخلقيين (اليهود والنصارى وغيرهم) في الخارج - مثل قولهم بأنهم يؤمنون بسلف أعلى للكائنات إلخ - : رغم أني ذكرت لك علو الإسلام عليهم جميعا وبقرآنه لأنه الكتاب المعجز الشامل المهيمن الذي لم يمسه التحريف والذي ينحني العلم أمامه ؟! - أيضا : - لماذا تتقبل اختلافك مع الخلقيين في إيمانهم بالتصميم الذكي وإنكارهم لتطورك الصدفي العشوائي والطفرات والانتخاب الطبيعي رغم أنه ضد ما تؤمن به : ولا تتقبل القول بوجود خلق مباشر وهو درجة أعلى من مجرد الإيمان بتصميم ذكي ؟!.. غريب ! ## ثالثا : وهو ادعاءك عليّ أكثر من مرة في مداخلاتك الأخيرة كلها بـ (التلفيق) ..! رغم أني لم أذكر شيئا - إلى الآن - إلا ومعه دليله أو مرجعه !!!.. وحتى ما لم أذكر مرجعه لضيق حجم المداخلات : فكنت أخبرك بأني جاهز لإحضار أي مرجع لما أذكره إذا طلبت .. وأما العجيب منك أستاذ هشام : فهو أنك لما جئت لتكذبني في اقتباسي المبتور لكلام دوغلاس فوتويما - على حد وصفك لي - : وأن السياق غير ذلك .. فكنت أتوقع أن تقتبس لنا السياق كله : حتى يتبين كذبي بالفعل !!.. ولكنك لم تفعل !!.. ولكن اقتبست لنا من مقدمة الكتاب ما يبين لنا أن الكتاب هو موضوع لمناصرة التطور على الخلق .. أقول : وماذا في هذا أستاذ هشام ؟؟.. بل سأعطيك مثالا أكبر من فوتويما ألا وهو : داروين نفسه في كتابه أصل الأنواع الذي روج فيه - باستماتة - لفرضياته المتهالكة .. أقول : هل يكون من الخطأ أن أقتبس من كتابه - وبلسانه ويده - ما يدينه إذا تحقق ؟؟.. لا والله !!.. بل هي من كمال الحجة عليه وعليكم !!.. وانظر مثلا لكلامه : " إذا كانت الأنواع الكثيرة التي تنتمي إلى نفس الأجناس أو الفصائل : قد دبت فيها الحياة فجأة (أي ظهرت فجأة في السجل الأحفوري) : فستمثل هذه الحقيقة ضربة قاتلة لنظرية انحدار الأنواع بالتحور البطيء من خلال الانتقاء الطبيعي " !!.. المصدر - Charles Darwin, The Origin of Species: A Facsimile of the First Edition, Harvard University Press, 1964, p.302 .. ويقول كذلك - ومكذبا لتهرباتك الكثيرة من عدم وجود أي حفريات لكائنات انتقالية أو وسيطة - وهو مؤسس النظرية وفاهمها أكثر منكم - : " إذا كانت الأنواع قد انحدرت من أنواع أخرى عن طريق التسلسل الدقيق : فلماذا إذن لا نرى في كل مكان أعداداً لا حصر لها من الأشكال الانتقالية ؟!!.. لماذا لا تكون الطبيعة كلها في حالة اختلاط : بدلاً من أن تكون الأنواع وكما نراها محددة تحديداً واضحاً ؟!!.. ولكن .. ووفقاً لما ورد في هذه النظرية : ينبغي أن يكون هناك عدد لانهائي من الأشكال الانتقالية ..!! فلماذا إذن لا نعثر عليها مطمورة بأعداد لا تعد ولا تحصى في قشرة الأرض ؟!!... لماذا لا نجد الآن في المنطقة المتوسطة التي تتسم بظروف حياتية متوسطة : أنواعاً متوسطة تربط بصفة دقيقة الأشكال البدائية بالأشكال المتقدمة ؟!!.. لقد حيرتني هذه الصعوبة منذ فترة طويلة من الوقت " !!.. المصدر - Charles Darwin, The Origin of Species: A Facsimile of the First Edition, Harvard University Press, 1964, pp. 172, 280 .. والسؤال الآن أستاذ هشام : هل عندما أقتبس مثل هذه الاعترافات - ومثلها العشرات في كتاب داروين - لأحتج بها عليك : فيكون ردك ساعتها أن تقتبس لي من نفس كتابه ما يقول فيه أنه يرفض الخلق المباشر والتدخل الإلهي ؟؟!! - وكما فعل عند محاولاته الفاشلة لتفسير تطور العين ؟! - .. أظن الإجابة واضحة أستاذ هشام ..
    ---------------

    51...
    ثلاثة أخطاء رئيسية ذكرتها أنت أستاذ هشام في محاولة تدليلك على تطور الإنسان : رغم أنه تم كشف خداعاتها وتدليساتها بالفعل !!!.. وعليه : يبدو أن معلوماتك لصالح التطور تحتاج لأب ديت Update .. وهذا لصالحك وحتى لا تتعرض للإحراج مستقبلا .. >> أما أول خطأ : فهو استدلالك بخرافة تشابه جينات الشيمبانزي والإنسان 98.5 % !!.. >> وأما ثاني خطأ : فهو استدلالك بما كان يسميه التطوريون بالجانك جين Junk Gene 45 % وهي تعني الجينات التي لا فائدة منها (أي بواقي تطور كما أشاعوا عنها لخداع الناس) .. >> وأما ثالث خطأ : فهو استدلالك بظاهرة الريتروفيروس ERVs .. وتحويلها من ظاهرة عادية : إلى دليل كاذب جديد للتطوريين ..!! >> حسنا .. وقبل الرد المفصل على هذه الثلاث محاولات أستاذ هشام : دعني أعلق أولا على قولك : "" ولكن ثمّة أمر يجد أن أتطرق إليه قبل أن أغوض أكثر في هذا الموضوع، فإننا نلاحظ أنَّ الإنسان ككائن مُدلل عن الآلهات (أو مُكرّم) يفتقر إلى كثير من الصفات التي تتمتع بها كائنات أخرى؛ فهنالك كائنات يُمكن الرؤية جيّدًا في الظلام، وهذه الخاصية لا يتمتع بها الإنسان، وهنالك كائنات بإمكانها أن تسمع أدق الأصوات التي لا يستطيع الإنسان سماعها إلا بواسطة أجهزة معقدة، كما أنَّ الإنسان لا يمتلك السرعة التي تتمتع بها غالبية الكائنات الحيّة، وكذلك فإنَّ أيًا منا لو حاول مُصارعة كائن أليف كالغزال مثلًا، فإنَّ العواقب قد تكون وخيمة بالنسبة للإنسان، فهو حتى لا يملك ربع القوة التي يتمتع بها الغزال. فأيّن هو التكريم؟ الحقيقة أنًّ الإنسان يتميّز عن بقية الكائنات بميزة العقل، وهذه حقيقة، ولكن هذه الميزة لا تجعله مميّزًا عن بقية الكائنات، ولكنها فقط تجعله متمايزًا عنها "" أقول : بل العقل الإنساني هو تمايز وتميز أستاذ هشام وإلا : فهل ترى كائنا ملأ الأرض سيطرة وإخضاعا لها برا وجوا وبحرا : واستغلالا لخيراتها : وعلوا على شجرات غذائها : إلا الإنسان ؟!!.. غريب !.. ولن أكرر عليك كلام ألفريد والاس ولا داروين من جديد - وأظنهم عندك لا يفهمون شيئا في التطور هم أيضا ! - ولكني أجدها فرصة للتعليق على نقطتين بتعليق واحد - عصفورين بحجر يعني - وهو : استغلالك لنقص الإنسان في بعض صفاته عن غيره من الكائنات : لتصور ذلك للقاريء بأنه يدل على كذب الادعاء الديني بتكريم الإنسان !!!.. أقول : في مثالك عن ساعة اليد العادية : وساعة اليد التي مواصفاتها كذا وكذا : قمت باختيار إحداهما : في حين لم تتطرق إلى احتمالية أخرى وهي أن : صانعها يريدها هكذا !!!.. وبمعنى آخر .. ماذا لو أن صانع الساعة لا يريدها كاملة ؟؟!!.. بل يريدها قوية في نواحي : ضعيفة في أخرى : وحتى يظل على تواصل دائم بأصحابها الذين يشترونها منه ؟!!.. فهكذا هو جسد الإنسان الذي وهبه الله تعالى لنا ..! فهو ليس كاملا لا يؤثر عليه شيء : لأنه لو كان كاملا لا يؤثر عليه شيء : لابتعدنا عن الله تعالى ولم نتذكر حاجتنا إليه : ولاغتررنا بقوتنا وأنفسنا إلى أن يقصمنا الله تعالى !!!.. واقرأ مثالا على ذلك إذا شئت : استكبار قوم عاد بأنفسهم واغترارهم بقوة أجسادهم !!!.. يقول عز وجل في سورة فصلت : " فأما عاد فاستكبروا في الأرض بغير الحق وقالوا من أشد منا قوة " !!.. أقول : ومن هنا أستاذ هشام أعود إلى سؤالك من جديد : "" فهو حتى لا يملك ربع القوة التي يتمتع بها الغزال. فأيّن هو التكريم؟ "" : أقول : إذا لم تكن ترى أن العقل وحرية الاختيار في التكليف بالإيمان أو الكفر تكريما : فعلى الأقل يسعك أستاذ هشام أن تفهم أن التكريم في العطاء : لا حاصر له في صفات معينة مثل القوة أو السرعة أو قوة الإبصار إلخ !!!.. وإلا : هل معنى أني اخترت طالبا من الفصل لتكريمه : فأعطيت له آلة حاسبة هدية : أن يمتعض أحد الواقفين ويقول : لماذا لم يعطه دراجة أو صندوق شيكولاتة ؟!!!.. وعلى العموم - وحتى تطمئن أستاذ هشام - : فإنه بعقل الإنسان المبدع الذي وهبه الله تعالى له : فقد اخترع السيارة والطائرة والصاروخ الذين هم أسرع من الغزال !!.. وقد اخترع البنادق والمسدسات والدبابات التي تهلك الحرث والنسل إلخ إلخ إلخ !!!.. والمثل الصيني يقول : " لا تعطني سمكا : وعلمني كيف أصطاد " !!.. أرجو أن تكون قد فهمت الفارق .. وأما إذا عكسنا الآية بسؤال إلى التطوريين وهو : لماذا تخلت الطبيعة عن هذه الصفات الرائعة في مختلف الكائنات الحية طوال سلم التطور : ولم تجتمع في كائن واحد أسطوري يكون على رأس شجرة التطور اليوم بدلا من هذا الإنسان ((الهزيل)) في رأيك ؟؟!.. هل يمكن أن يكون الانتخاب الطبيعي قد وصلت به الحكمة - والذكاء - أن تتعدى سلطته من الكائنات الحية : إلى النظر في توازنات ((كوكب الأرض)) بأكمله ؟!!.. لا لا لا .. هذا كثير بالفعل ما شاء الله ؟!!.. ماذا لو كانت الصقور تبيض عددا من الأبناء مثل الذباب ؟!!.. ماذا لو كانت الأسود تلد عددا من الأبناء مثل الأرانب وبنفس معدلاتها ؟!!.. ماذا لو كانت كل الخلايا الحية هي خلايا فيروسية ((تتضاعف بمرات أسرع بكثير من الخلايا العادية)) ؟!!.. ماذا لو اختلت دورات الكربون والفوسفات والنيتروجين في الطبيعة ؟!!.. أظنها أسئلة لا يعنيك الإجابة عنها أستاذ هشام : لأنها تضع الانتخاب الطبيعي في زاوية جديدة من تلك التي تفضح خرافته : ومثلها في ذلك مثل زاوية قصور الطفرات وانعدام الحفريات الوسيطة وعقم الحوض الجيني على تخطي التطور له !!!.. والآن : أبدأ في مناقشة ادعاء تشابه الجينات بين الإنسان والشيمبانزي 98.5 % ..


    التعديل الأخير تم 03-11-2013 الساعة 11:42 AM

  11. #11

    افتراضي

    " حسنًا .. السؤال البديهي الذي يطرح نفسه في هذه الحال (طالما أنَّ كل شيء لابد له من موجود) هو: وكيف أو من أوجد الله؟ هذا سؤال مُستهلك للغاية، أترك لك حرّية الإجابة أو عدم الإجابة عليه "" أقول : بل أجيب عليه .. وذلك بمثال صغير .. يمكنك التعليق عليه إذا أردت .. والمثال سنتصور فيه معا ً: جنديا ًينتظر أمر إطلاق النار من قائده .. وقائده : ينتظر أمر إطلاق النار من قائده .. وقائده ينتظر أمر إطلاق النار من قائده ....... وهكذا إلى ما لا نهاية .. فهل سيتم إطلاق النار ؟!!.. الإجابة هي لا !!!.. إذا ً: يستحيل تسلسل المسببات إلى ما لا نهاية وإلا : لم نكن لنرى شيء أصلا ًولا مخلوقات إلخ إلخ إلخ .. ومن هنا : وطالما أنا موجود وأنت موجود والكون موجود إلخ : فدل ذلك على تلقي الأمر الأولي بالفعل من ذات : ليس قبلها شيء !!.. ولا تعتمد على أمرها في شيء : أزلية ليست حادثة !.. ولذلك وصف الله تعالى نفسه في قرآنه باسم " الأول " .. وقال عنه رسولنا الكريم كما في الدعاء الشهير الذي رواه مسلم مسلم والترمذي وأبو داود وابن ماجه وأحمد : " أنت الأول فليس قبلك شيء " .. وكذلك أيضا ًوصفه الفلاسفة والمتكلمين بـ (واجب الوجود) و (العلة الأولى) إلخ ..
    و(مَن) الذي اختار أن يكون هناك فراشات بأجنحة خلابة الأشكال والألوان : أو أن تكون بغير زخرفة أصلا : أو بأشكال قبيحة !!.. مَن ذلك الذي (استشعر) الجمال وقرر واختار واستبعد أو أبقى ؟!!!.. هل هو الانتخاب (الطبيعي) ؟؟.. ذلك الكيان الهلامي الذي لا وجود مادي له في الحقيقة ؟!!.. إذا ً.. الانتخاب (أو الانتقاء) الطبيعي له معضلتين وهما : أنه لا يستطيع تفسير ((كيفية)) ظهور التركيبات والأعضاء والصفات الأساسية ((الجديدة)) في الكائنات الحية مع الزمن -ومن هنا جاء الاعتماد على الطفرات في الداروينية الجديدة - والمعضلة الثانية هي أنه لا يستطيع أن يفسر لنا الانتقائية في الاستبعاد او الإبقاء : والتي تتطلب (عقلا واعيا مختارا له وعي وحرية اختيار وإرادة) !!.. وهذا مزلق من المزالق التي (ابتدعها) داروين في كتابه أصل الأنواع وسخر منها العقلاء !!!.. ذلك أنه استخدم في وصفه للانتخاب الطبيعي : نفس صفات ما يحدث من الانتخاب الصناعي (أي بفعل الإنسان) عند التهجين !!.. حيث ينظر المزارع مثلا لصفات الأبقار أو الأرانب أو الداجن عموما : ليمايز بين صفات الأنواع .. ثم يقيم .. ثم يقرر التخليط والتهجين بين أفضلها أو ما يعطيه النتائج التي يرد (داخل النوع الواحد وليس خارجه) : ثم يقوم بالتهجين ..! فأتى داروين وبعد أن تحدث عن كل هذه الآليات في كتابه : فخلعها على الانتخاب الطبيعي بكل سذاجة وسطحية !!!.. ينتقد ذلك العالم التطوريستيفن جولد نفسه Stephen Gould : معتبرا إياها خللا في آلية الانتخاب الطبيعي ((المفترض)) فيقول تعليقا عليها في كتاب داروين : The principle of natural selection depends upon the validity of an analogy with artificial selection المصدر - Stephen Gould - Ever Since Darwin p 41
    جناح الطيور مثلا !!!!.. فجناح الطيور التي تطير - وفضلا عن أجسامها - هو فريد في تكوينه بطريقة تطابق وظيفة الطيران !!.. ولا يتخيل كائنا من كان أنه ظهر بالتدريج ((العشوائي)) : اللهم إلا الذي لا يعرف شيئا عن تكوين الأجنحة والريش في الطيور البتة !!!.. بدءا من التكوين الفريد لعظامها لتكتسب قوة وصلابة ولكن مع خفة !!!.. أو مع تكامل نظام التغذية الدموية للريش والجناحين لمدهما بالطاقة !!!.. أو مرونة العضلات التي لا تحترق مع كثرة الرفرفة !!.. وانتهاء بالتصميم الديناميكي الهوائي المبدع للريش وتفرعاته إلخ إلخ إلخ .. والشاهد : أنه من العبث القول بأن التطور لا يعني التعقيد بالضرورة !!!.. بل هذا تهرب وعجز تفسير التعقيد في الكائنات الحية !!!.. ومن العبث أيضا القول بأن التطور هو ظهور صفة جديدة - هكذا بكل بساطة وسطحية - : وذلك لأن العضو الواحد ((الجديد)) لكي يظهر في الكائن الحي : يجب أن يظهر كاملا مرة واحدة وبمستلزماته من جهاز عظمي ودوري وعضلات وأعصاب وهدف جديد في البيئة : وإلا لو ظهر على مراحل (جدلا) عن طريق الطفرات : فهو في كل مرحلة هو بلا الفائدة : ولأنه لم يكتمل بعد !!.. ولكان بهذا قد تخلص منه الانتخاب الطبيعي (نفسه) عندكم : لأنه يتخلص من كل ما هو ضار وغير نافع مما يظهر على الكائنات الحية من طفرات !!!!.. إذا ً: القول بالتطور بالطفرات المتدرجة : ينسفه مفهوم الانتخاب الطبيعي المزعوم نفسه !!!.. اللهم إلا تحليتم بـ (الانتقائية) وقلتم أن الانتخاب الطبيعي : تارة يتخلص من الطفرات الغير مفيدة (وإلا لكنا رأينا اليوم ملايين المخلوقات المشوهة بعدد الطفرات التي تفترضونها بعشوائيتكم) : في حين تارة أخرى يترك بعض الطفرات والتي - ويا للمصادفة المبهرة - تكون هي المفيدة على المدى البعيد الذي لا يعرفه أحد ولا يعرف له غاية مسبقة بعد (مثل ظهور جناح للطيران) !!!!.. >>>
    جزاكم الله خيرا على هذه المعلومات المفيدة

  12. #12

    افتراضي

    مناظرة مع الملحد هشام آدم بعنوان : وجود الله ..
    الجزء 6 ...
    جرت هذه المناظرة في جروب (نقاش فكري) على الفيسبوك ..
    وقد انتهت بانسحاب الملحد بأعذار أني أخطأت ولفقت ودلست فيها .. ولله الحمد ..!
    ---------------

    52...
    والآن نأتي أستاذ هشام لأولى أخطائك وهو محاولات التقريب بين الإنسان والشيمبانزي (جينيا) .. حيث وجدوا أولا أن الشيمبانزي يملك في خلاياه : 48 كروموسوم (أي صبغي) .. والإنسان يملك : 46 ! وعلى ذلك بنوا أولى كذباتهم من تقارب الاثنين على شجرة التطور ! وتغافلوا بالطبع أن المسألة لا تتوقف على عدد الكروموسومات وإلا : فإن نبات البطاطا مثلا يملك 48 كروموسوم مثل الشيمبانزي ! وكذلك أحد أنواع الأرانب jack rabbit لديه 48 كروموسوم ! بل ودعنا من عدد الـ 48 كروموسوم كالشيمبانزي : ولنتحدث في عدد يطابق عدد كروموسوماتنا نفسها الـ 46 ! حيث نرى أحد أنواع الغزلان Reeves's Muntjac يملك مثلنا عدد 46 كروموسوم ! وكذلك أحد أنواع الظباء Sable لديه 46 كروموسوم ! ومن هنا : انتقل الملاحدة والتطوريون للمرحلة الثانية من الخداع - وبعد فشل اللعب على عدد الكروموسومات - : ألا وهو اللعب على (نوع) و(تشابه) الجينات نفسها بين الإنسان والشيمبانزي ! فماذا فعلوا ؟؟.. قاموا بخدعة شهيرة في عام 1987م ادعوا على آثارها تشابه جينات الإنسان والشيمبانزي بنسبة 98.5 % ! - ألم أقل لك أستاذ هشام أن بعض معلوماتك المغلوطة قديمة جدا - ؟! وكان هذا الإعلان - وبصيغته التعميمية هكذا - : كفيلا بالطبع لخداع وبلبلة أي أحد من مكذبي التطور ! ولكن : هل هناك أي معنى لذلك على أرض الواقع علميا ً؟! أقول : وقبل فضح التجربة التي قاموا بها : أوضح أولا أنه بالفعل : تشترك الكائنات الحية في الكثير جدا ًمن الصفات الحيوية وتركيباتها الخلوية وأحماضها النووية ! وذلك يفسر لنا نسبة التشابه الطبيعية - والمتوقعة - في الكثير من الجينات ! - فالغزال مثلا : يلد بالفعل مثلنا ويرضع ويأكل ويتنفس ويجري وله قلب ومعدة ورئتين إلخ - ومن الجهة الأخرى : فالجزء الأكبر من الحمض النووي - وهو الذي كانوا يسمونه جانك جين : أي لا فائدة منه - : هو له بالفعل وظائف متشابهة : من انقسام الحمض النووي : إلى نسخه إلى ترجمته لبروتينات إلى تصحيح الأخطاء إلخ .. وهي وظائف واحدة في كل الكائنات الحية كما قلت ! ولكن ... لماذا الإنسان والشيمبانزي بالذات أعلنوا عنهما هذه النتيجة الغريبة ؟! وهل بالفعل تلك النسبة الـ 98.5 % : هي لكل جينات الإنسان والشيمبانزي ؟ أم أنه لجزء منها فقط ؟! أقول : في عام 1987 قام عالمان داروينيان وهما : سيبلي Sibley و ألكوست Ahlquist : بدراسة 30-40 حمض أميني ((فقط)) في الشمبانزي : ومقارنتها بتلك الموجودة في الإنسان ! ثم خرجوا بنتيجتهما المتحيزة - والتي لم تتزعزع من ساعتها إلى اليوم في الأوساط الداروينية والتطورية والإلحادية - ثم قاما بنشر بحثهما في مجلة داروينية شهيرة ! المصدر - Sibley and Ahlquist, Journal of Molecular Evolution, vol. 26, pp. 99-121 .. وعلى هذا : فالمثير للجدل في هذا الأمر : هو أن تلك الدراسة قديمة كما رأيتم معي - منذ عام 1987م - : في حين لم يكن أحد بعد قد استطاع رسم خريطة الجينوم البشري بأكمله : تلك التي لم تنته إلا في عام 2001م - أي بعد نتيجتهما المتحيزة بـ 14 عام - ! فعلى ماذا خرجوا بهذا (التعميم) الذي (يدمنه) التطوريون والملاحدة من التصريحات الخادعة : بأن تشابه (كل جينات) البشر والشيمبانزي هو بنسبة 98.5 % ؟! أقول : ثم ..... ماذا تمثل نسبة 30 أو 40 حمض أميني - وهم الذين جرت المقارنة بينهم - إلى جانب 100 ألف حمض أميني أو بروتين في خلية الإنسان ؟! والكلام بمعنى آخر : فإن نسبة ما قاموا بمقارنته هو 1 : 2500 ! وهو ما لا يتم ذكره بالطبع لدى الملاحدة ومروجي التطور عند إعلانهم هذا الخبر الساحق الماحق وهو : نسبة تشابه جينات الإنسان والشيمبانزي : 98.5 % ! وليس هذا فقط ! بل إن التجربة نفسها التي استخدمها العالمان في المقارنة : هي تجربة قليلة الاستخدام أصلا ًومثيرة للجدل ! ألا وهي تجربة الـ DNA التخليطي ! وقد قام أحد العلماء ويدعى ساريش Sarich : باستخدام نفس التجربة على نفس البروتينات التي قام بها العالمان : فكانت المفاجأة ! وهي أنه اكتشف أن مصداقية أبحاثهم : هي مثيرة للجدل هي الأخرى ! وأن البيانات التي أعلنوا عنها : كانت مبالغ فيها إلى حد كبير ! وأن نسبة التشابه - وحتى في هذه النسبة الصغيرة من الأحماض الأمينية - : هي أقل من ذلك بكثير ! المصدر - Sarich et al. 1989. Cladistics 5:3-32 ؟..! وبهذا ظهر فشل المحاولة برمتها ! وتأكيدا على ذلك : فإن نسبة التشابه بين الإنسان والدجاج مثلا ًكبيرة : وهي نتيجة من بحث لجامعة كامبردج ! المصدر - New Scientist, v. 103, 16 August 1984, p. 19 .. بل والأعجب : نسبة التشابه بين الإنسان وديدان النيماتود nematode : تصل إلى 75% ! المصدر - New Scientist, 15 May 1999, p. 27 .. وكذلك نسبة التشابه بين الإنسان وذبابة الفاكهة 60% ! المصدر - Hürriyet daily, 24 February 2000 .. بل والأعجب : أنه في مجلة SCIENTIFIC AMERICAN الداروينية الشهيرة عدد ديسمبر 2009م : وفي مقال بعنوان : ما الذي يجعلنـا بشرا what makes us human ؟! قامت الباحثة كاتبة المقال بدراسة متوالية DNA في أحد الجينـات ويُطلق عليه اسم HAR1 .. وقامت بدراسة هذا الجين في كل من الإنسان والشمبانزي والدجاج .. مع العلم بأن عدد قواعده النيتروجينية 118 قاعدة - أي أكثر مما قاموا بمقارنة الإنسان والشيمبانزي به - .. فماذا اكتشفت ؟ اكتشفت وحسب النتائج أن الدجاج : أقرب للشيمبانزي من الإنسان ! حيث الاختلاف في متوالية الـ DNA الـ 118 بين الشمبانزي والدجاج كانت : 2 فقط ! وأما بين الدجاج والإنسان فكانت : 18 ! فهل يعني ذلك أي شيء بالنسبة للتطور وخرافاته وآلياته الأسطورية ؟!
    ---------------

    53...
    وكعادتي في حب التوسع في الإجابة أستاذ هشام - لغرض زيادة توعية القاريء - : فبالنسبة لخطأك الثاني وهو محاولتك للاستدلال بما أسماه التطوريون زورا وبهتانا بالجانك جين (أي بقايا جينات التطور في الإنسان والتي تراكمت في حمضه النووي بلا فائدة) أقول : وبغض النظر عن التناقض المضحك للتطوريين عندما يرسمون للانتخاب الطبيعي تارة : الحارس الأمين الذي يقضي على كل طفرات غير مرغوبة - أولا بأول - ثم يرسمونه مرة أخرى - وعند الحاجة - في صورة المغفل الذي مرت من تحت يديه ملايين الطفرات الغير مفيدة فتركها : أقول : بغض النظر عن ذلك التناقض : فأحب أن أرجع بالقاريء أولا لواحدة من أشهر الخدعات التطورية قديما وهي : خدعة استغلال كل ما جهله الإنسان من وظائف الأعضاء حسب إمكانيات عصره العلمية : وادعاء أنها ((زائدة)) لا فائدة منها : مما يؤكد ((صدفية)) و((عشوائية)) الخلق !!!.. وقد بدأت هذه الخدعة (رسميا) عام 1895م : وذلك على يد عالم التشريح الألماني الدارويني : Wiedersheim .. حيث أعلن عن قائمته ذات الـ 100 عضو مما أسماهم بزعمه : أعضاء ضامرة vestigial organs !!.. ولعل من أشهر هذه القائمة هي الزائدة الدودية (ولاحظوا كيف التصق وصف - زائدة - بها لما يقارب المائة عام) ثم اكتشف علماء التشريح والوظائف الحيوية والمناعة لها مؤخرا فائدة ألا وهي : احتوائها لأنواع من البكتيريا المفيدة في عملية الهضم في المعدة : مع ارتباطها أيضا - وبحكم مكانها في نهاية المصران الغليظ - بتنظيم كمّ البكتيريا التي يجب أن تكون في جهاز هضم الإنسان : وخصوصا بعد إصابة الإنسان بالأمراض الطفيلية والكوليرا والزحار والإسهالات : لأنه بهذه الأمراض وعلاجها يكاد أن تنعدم من بعده البكتريا النافعة من المعدة ..! فتبرز هنا أهمية هذه الزائدة - والتي لم تعد زائدة - .. Scientists Find Reason For The Appendix; Protects Good Germs .. وعلى نفس الوتيرة صارت موضة التطوريين والملاحدة البحث عن مثل هذه التفاهات والتي يفضحهم العلم بها كل يوم ويثبت لها فوائد مثل : بقايا ذيل الإنسان !!.. حلمات الرجال !!.. نتوء داروين في بعض أذن الإنسان !!.. العصب الراجع في الزرافة !!.. عيون أسماك الكهوف المظلمة !!.. أجنحة الطيور التي لا تطير إلخ إلخ إلخ : وكلها قد أجبت عليها بحمد الله تعالى في موضوع : ((ما يجب أن تعرفه عن نظرية التطور)) .. فإذا أخذنا مثلا أجنحة الطيور التي لا تطير - وسأكتفي بها الآن لعدم التطويل ولأنها قد ذكرها الأستاذ هشام - أقول : من العجيب أولا ألا يرى إنسان عاقل : الإعجاز المبهر في الطيور : حتى يتركه ليلتفت لمثل هذه الشبهة المتهافتة !!.. تلك الطيور التي ريشها معجز !!.. وكذلك جهازها التنفسي الفريد بين كل الكائنات الحية !!.. وكذلك عظامها التي جمعت بين القوة والخفة !!.. وحويصلاتها الهوائية !!.. وأحشائها المتوائمة مع وظيفتها !!.. واختلاف تكوين ووظيفة ريش الجناحين عن الذيل عن باقي ريش الجسم !!.. وكذلك التحام عظامها !!.. وكذلك مرونة عضلاتها الرهيبة !!.. وكذلك عيونها المتوائمة مع النظر في الشمس !!.. فما أشبه مَن يتجاهل كل ذلك ليناقش في تفصيلة واحدة : هو يعلم يقينا أن مَن أبدع هذا الطائر لم يكن ليقع في أخطاء تافهة مثلها كما يشيعون : فمثل هذا مثل رجل وقف أمام قصر رائع عظيم بديع : غاية في الإحكام والبناء والدقة والألوان : فلم يُعلق على كل ذلك بشيء وإنما جاء إلى ميل أرضية سطح القصر عن الاتجاه الأفقي لينتقدها : وليدعي أنها بلا فائدة - وكان الوقت صيفا - ليخرج من هذه الملاحظة اليتيمة أن هذا القصر العظيم المحكم : لا صانع له وإنما هو صدفة !!!.. فهذا بالضبط هو ما يفعله التطوريون والملاحدة بمحاولاتهم (الصبيانية) لترويج خرافاتهم على العامة والبسطاء - مثل أن يتجاهلوا الإعجاز في توصيل وضخ دم الزرافة إلى رأسها ضد جاذبية الأرض لمسافة تقارب 3 أمتار : فيتركون كل ذلك الإعجاز ليتحدثون عن العصب الراجع ! - أقول : فلما أتى وقت الشتاء : وأمطرت السماء بالماء الغزير : ظهر حينها فائدة ميل سطح القصر ألا وهو : تصريف ماء المطر !!!.. وعليه أقول :
    ---------------

    54...
    الطيور مثلها مثل باقي أنواع الكائنات الحية التي بثها الله تعالى في الأرض : فقد وزعها سبحانه بحكمته لتقيم التوازن الدقيق في دورات الغذاء والحياة شأنها شأن كل مظاهر اتزان الأرض المعجز .. ولو لاحظ المشككون : لوجدوا أن هناك عدد كبير جدا من الطيور التي : تطفو على الماء !!.. والتي : تغوص في الماء !!.. والتي تقضي معظم أوقاتها في الماء !!.. وهناك من الطيور مَن يبقى على الأغصان ولا يمشي على الأرض !!!.. وهناك من الطيور مَن لا يطير وإنما يقفز لأمتار ويعدو ..! إذا ً: المسألة مقسومة وليست اعتباطا .. وبالنظر مثلا للبطريق : نجد جناحيه غاية في كمال التصميم للغوص الكبير والسباحة السريعة تحت الماء !!!.. وبالنظر مثلا للنعامة : نجد قدميها قويتين وطويلتين ومرنتين للعدو بسرعة هائلة على الأرض واستخدام جناحيها في الدوران المفاجيء في المناورات وفي التوجيه !!.. وكذلك الدجاج ..! فقد سخره الله تعالى للإنسان منذ فجر التاريخ كما هو مدون في كل الحضارات !!.. وفي العلم الحديث وجدوا تقاربا كبيرا بين جينات الدجاج والإنسان - مما يعطي بُعدا آخرا لتسخير الله تعالى له كطعام أساسي للإنسان كلحم وبيض ! - وبالنظر لريش ذيل الدجاج والديكة : نجده رأسي وليس أفقي كالحمام مثلا !!!.. مما يؤكد أنه لم يخلق ليطير بالفعل - هناك تناغم بديع في تبادل عمل وتكامل كل ٍمن ريش الذيل والجناحين في الطيور التي تطير - بالإضافة لوظيفة ريش الجناحين أصلا في التدفئة للجسم وللصغار - حتى صار الدخول تحت الجناح هو مثال للرحمة وكما جاء في التعبير القرآني : فاخفض لهما جناح الذل من الرحمة ! - إذا ً: الاختلاف والتنوع الرهيب في الطيور : في الحجم والمناقير والمخالب والأقدام والريش والأجنحة والطيران أو العدو أو الغوص إلخ : هو لغايات محكمة لا ينكرها إلا جاهل أو متحامل أو مخدوع !!.. والآن .. نأتي للحديث عن الجانك جين أو الجانك دي إن إيه Junk DNA
    ---------------

    55...
    >> أقول .. عندما نستخدم الطائرة مثلا : فنحن فعليا - وكغير متخصصين - لا نحتك ولا نعرف إلا الجزء الذي نستخدمه مباشرة وهو الجلوس وشاشة العرض ودورة المياه والطعام والدخول والخروج ..!! حسنا .. ماذا لو أحضر أحدهم لنا جزءا من أجزاء محرك الطائرة : هل سنعرفه ؟؟.. الإجابة بالطبع : لا !!.. طب هل سنعرف فائدته ونحن عوام وغير متخصصين وغير دارسين ولا باحثين في مثل هذه الأشياء ؟؟.. الإجابة أيضا : لا !!.. طب - وأخيرا - : هل يمكن القول عن هذا الجزء - ومعه باقي مكونات الطائرة الميكانيكية المعقدة التي تحركها - : هل يمكن القول عنه أنه ((بلا فائدة)) في تسيير الطائرة : لأننا لا نعرفه ؟!!.. إذا ً.. وبالقياس من هذا المثال : فإن المساحات الشاسعة والطويلة جدا على شرائط الحمض النووي (والمسماة بالانترونات Introns وتبلغ أحيانا 90 % من المناطق المشفرة في الحمض النووي) : والتي ليس لها ترجمة لجينات محددة - ولذلك كانوا يظنونها بلا فائدة - : فقد ظهر أنها هي المايسترو والقائد الحركي في الكثير من عمليات التعبير الجيني والنسخ !!!.. بل وتعمل هي والإكسونات Exons على تغيير التعبير الجيني للجين الواحد بأكثر من شكل أحيانا وعلى حسب الحاجة !!!.. ورغم أن هذه الحقائق باتت يقينية وبتفصيل كبير في العام المنصرم 2012م وكما جاء في مواقع علمية مثل scientificamerican و sciencemag : إلا وأن إرهاصاتها بدأت بوضوح منذ 2001م !!!.. حيث مع الانتهاء من فك الجينوم البشري : لاحظ عدد من العلماء احتفاظ هذه المساحات الشاسعة بمعلومات هامة جدا عن كل شيء تقريبا - وكما قلت - مثل : النسخ والتعبير الجيني والإصلاح بل : والاحتفاظ بمعلومات عن الأمراض كالسرطان ونحوه !!!.. وذلك بصورة صادمة لأولئك الذين كانوا يستخفون بها من قبل !!.. حتى أنهم شبهوا صدمتهم تلك بأنك عندما تفتح كتيب تعليمات (( آلة صغيرة )) اشتريتها : لتجد الكتيب عبارة عن 300 صفحة بالتفصيل !!!!!!!!... ففي مقال للواشنطن بوست بتاريخ 4 ديسمبر 2002م نقرأ فيه قولهم : The huge stretches of genetic material dismissed in biology classrooms for generations as "junk DNA" actually contain instructions essential for the growth and survival of people and other organisms, and may hold keys to understanding complex diseases like cancer, strokes and heart attacks, researchers reported today .. والترجمة التقريبية : " إن المساحات الضخمة من المواد الجينية التي رفضت الاعتراف بها الفصول الدراسية البيولوجية على مدى أجيال وأسموها بالـ Junk DNA : قد اتضح أنها فعليا ًتحتوي على تعليمات أساسية لنمو وحياة البشر وسائر الكائنات الحية الأخرى !!.. بل وقد تحمل مفاتيح فهم الأمراض المعقدة مثل السرطان والسكتات الدماغية والقلبية !!.. هذا ما أكدته الأبحاث اليوم " ..! ومن نفس المقال أيضا نقرأ - ولاحظوا أنه من 2002م ! وهي المعلومات التي يخفيها أكابر التطوريين والملاحدة على أتباعهم إلى اليوم - : the new material appears to consist mostly of instructions for how the body should use its genes--when and where to turn them on and off, for example, and for how long .. والترجمة : " يبدو أن تلك المواد المكتشفة جديدا ًتحمل أغلب التعليمات التي تدل الجسم على كيفية استخدام جيناته !!.. على سبيل المثال : متى وأين يُفعل عمل جينات معينة أو يُبطلها !!.. وإلى أي مدة " !!!.. والنقولات كثيرة : ومن المجلات المتخصصة نفسها مثل ما جاء مثلا في عدد 29 أغسطس 2002م من مجلة الطبيعة sciencedaily عندما تحدثت بكل وضوح عن الوظائف الهامة لتتابعات الألو Alu sequences ..!! والتفاصيل والنقولات كثيرة .. ولكني أود أن أختم بباقة من أكاذيب التطوريين الذين ((لا يستحون)) من أنفسهم وإلى اليوم !!!.. فهذا البيولوجي فرانسيز كولينز Francis Collins (ومن 2006م) يقول : " أن ما يقارب الـ 45% من الجينوم البشري : ما هو إلا بقايا وحطام جينات لا فائدة منها ولا وظيفة " !!!.. " Roughly 45 percent of the human genome [is] made up of genetic flotsam and jetsam " ..! وهذا البيولوجي ريتشارد داوكينز Richard Dawkins ما زال يقول بغير حياء (وكلامه من 2009م !!) : " أن الجزء الأكبر من الجينوم : لا فائدة منه ويستوي وجوده بعدمه " !!.. It is a remarkable fact that the grater part of the genome might as well not be there, for all the difference it makes " ..! وهذا البيولوجي جون أفيس John Avise من جامعة كاليفورنيا يقول (وفي 2010م) وبغير حياء : " أن الجانك دي إن إيه الغير حامل لترميز الجينات : يمثل الغالبية العظمى من الجينوم البشري !!.. " Noncoding repetitive sequences – junk DNA- comprise the vast bulk of the human genome " !!..
    ---------------

    56...
    ونأتي الآن للخطأ الثالث في محاولة الأستاذ هشام للتدليل على تطور الإنسان من سلف مشترك مع القرود والشيمبانزي !!.. ألا وهو شبهة الريتروفيروس ERVs (أو الفيروسات الارتجاعية : أو آثار الفيروسات) .. والشبهة باختصار - ولا يكررها إلا الجاهلون بعلم الفيروسات كما سنرى من فرط تفاهتها وخطأها الواضح - أقول : الشبهة باختصار هي في أنه عندما يصيب فيروس معين الإنسان : فإنه يترك أثرا على شيفراته الوراثية - لو تتذكرون كلامي الماضي عن الجانك جين وكيفية دراستهم للأمراض وتاريخها وسلوكها من خلاله ! - .. ومن هنا : فقد وجد المدلسون أن مواقع نفس آثار فيروسات الأمراض : هي واحدة في كل من الإنسان والشيمبانزي - وهكذا بدأ التدليس أولا بين الإنسان والشيمبانزي ليتم تمرير فكرة تطورهما عن سلف مشترك ! - ثم لما وجدوا أن نفس مواقع آثار الأمراض المعينة : هي واحدة في الحمض الوراثي لكل الكائنات الحية المتقاربة في التكوين : فقالوا - وبتدليس أوسع - أن ذلك علامة (أكيدة) على السلف المشترك لكل الكائنات الحية : بدليل تناقل الكائنات الحية أثناء تطورها لجميع آثار الفيروسات الرجعية (الريتروفيروس) !!.. وأقول .. هذا الكلام محض خرافات وتدليسات كان الأجدر بمَن يحترم نفسه وعقله ألا يكرره إلا بعد أن يتعلم أولا : عن ماذا يتحدث !!!.. والموضوع ببساطة واختصار : هو أن الفيروسات كائنات تطفلية : عالية الاختيارية والانتقائية والدقة في تطفلها على الكائنات الحية !!.. وذلك بحيث أن كل فيروس معين : لا يهاجم ولا يصيب إلا مكانا معينا محددا على الحمض الوراثي للكائن الذي سيصيبه !!.. فالفيروس يعتبر خامل أو في عدم حركة ونشاط : إلا عندما يصيب كائنا حيا !!.. ساعتها : يبدأ في السيطرة على مجموعة الخلايا التي سيصيبها وينسخ نفسه بالتضاعف فيها ويسخرها له .. هذا هو الأمر باختصار شديد وتبسيط !!.. < ومنه جاءت فكرة عمل فيروسات الكمبيوتر !!.. حيث كل فيروس وبمجرد دخوله لجهاز الكمبيوتر : ينتقل مباشرة إلى جزء معين ومحدد وخاص به : هو الذي صممه له مبرمجه : ليصيب الجهاز بالعطب .. منه ما يذهب لملفات الإقلاع أو ملفات تشغيل البرامج أو ملفات النسخ إلخ > وعليه : نجد أنه من الطبيعي أصلا أن تتطابق أماكن الريتروفيروسات في كل الكائنات الحية للفيروس الواحد !!.. لأنه لن يصيب أصلا إلا مكان معين في الشريط الوراثي !!!.. فما العجيب هنا ؟؟.. اللهم إلا العجب هو قدرة (فيروسات الإلحاد ودعاة التطور) على التدليس على العوام والبسطاء وقلب الحقائق بالأكاذيب المفضوحة لصالح خرافة التطور ؟!!.. وهنا ملحوظة قلما يلاحظها أحد أيضا وهي : أنه لا يوجد عالم تطوري ((محترم)) ومتخصص في البيولوجيا الجزيئية والفيروسات : يثير شبهة الريتروفيروس هذه إطلاقا ودلالتها المزعومة على التطور !!!!.. لأنه يعلم أنها لا شيء !!!.. بل على العكس تماما : العلماء يعكفون على الاستفادة من المعلومات القيمة للسلوك العالي الانتقائية والتخصص لمواقع الريتروفيروس على الشريط الوراثي (حيث يختار غالبا أماكن بدايات النسخ أو الجارية النسخ بالفعل ليضمن سرعة الانتشار مثل مواقع تتابعات الألو لو تتذكرون في حديثي عن الجانك جين : Retroviral elements in Alu-rich domains would be expected to be actively transcribed in all cells) .. أيضا وجدوا أن للريتروفيروس علاقة كبيرة مع جين هام جدا في بناء المناعة من الفيروسات (مثل فيروسات السرطان) وهو جين p53 (والذي يطلق عليه master gene أو guardian of the genome) .. والخلاصة حتى لا أطيل : قد وُجد أن عملية اندماج الريتروفيروسات (البشرية) و(الحيوانية) في الجينوم المستضيف لها لا تأتي عشوائياً أبدا : بل نرى مثلا فيروس الـ Murine Leukemia يختار ويفضل مواقع بداية الترجمة start sites على الشريط الوراثي !!.. في حين يفضل مثلا فيروس نقص المناعة المكتسبة HIV (الأيدز) : الدخول في الجينات التي في حالة ترجمة بالفعل !!.. ورغم أن المواقع المفضلة للريتروفيروسات الحديثة المسببة للأمراض قد انحرفت عن المواقع التي كانت تستهدفها قديماً .. إلا أن وجود هذه الظاهرة بحد ذاتها يدلنا على أن للريتروفيروسات خاصية الدخول إلى مواقع محددة بدقة highly-specific .. ولا تستهدف غيرها ..! ليس هذا فحسب .. بل إن وجود هذه الريتروفيروسات على الشريط الوراثي بالفعل : يمنع إصابة الخلايا بفيروسات أخرى : أشد ضرراً !!.. وذلك لأنها تمنع تمركز جيناتها في المواقع التي تتواجد فيها : وذلك وفق تكنيك يُسمى بالـ homology-dependent gene silencing .. وأكتفي بهذا القدر في هذه الأخطاء الثلاث من كلام الأستاذ هشام .. لأنتقل بالتفنيد لباقي كلامه للأسف ..
    ---------------

    57...
    >>> حيث ننتقل الآن إلى معضلة أخرى حاول الأستاذ هشام تجاوزها وهي : معضلة صغر وقت الانفجار الكمبري - 5 ملايين سنة بقياساتهم - : والذي ظهرت فيه (فجأة) أول الكائنات الحية البحرية الكاملة التعقيد وبلا أية تدريجات أو مقدمات : وكما هي عليه إلى اليوم !!!.. أقول : إذا أردنا ان نتخيل مقدار 5 ملايين سنة مقارنة بعمر الأرض : فسنتخيل أن عمر الأرض (4.5 مليار سنة تقريبا) : سنتخيله يساوي يوما كاملا (أي 24 ساعة) .. ساعتها يكون ظهور أول كائنات حية معقدة لتملأ بحار العالم فجأة وبكامل تعقيدها : لم يستغرق إلا 1/10 من الثانية من اليوم !!!!!!!!!!!!.. أي عُشر الثانية الواحدة من 24 ساعة !!!.. وقد حاول الأستاذ هشام بلا جدوى تمطيط هذا الوقت إلى 15 مليون سنة بدلا من 5 فقط ولكن : بلا جدوى !!!.. (وماذا فرقت ثلاثة أعشار الثانية مقارنة بيوم كامل 24 ساعة ؟!) .. وقد ذكر ستيفان سي. مير Stephen C. Meyer وبي. إيه. نِلسون P. A. Nelson وبول شين Paul Chien في مقالة تتعلق بهذا المجال بتاريخ 2001م ذكروا أن : " الانفجار الكمبري حدث خلال فترة زمنية قصيرة للغاية من الزمن الجيولوجي : لم تدم لأكثر من 5 ملايين سنة " !!!.. المصدر - The Cambrian Explosion: Biology’s Big Bang, 2001, p .. وفي هذا الصدد أيضا ًقدم ريتشارد موناسترسكي Richard Monastersky الكاتب في جريدة ساينس نيوز Science News journal التصريح التالي حول الانفجار الكمبري : والذي يشكل مأزقا خطيرا بالنسبة لنظرية التطور : " قبل نصف بليون سنة : ظهرت فجأة أشكال الحيوانات شديدة التعقيد التي نراها اليوم !!.. وترمز تلك اللحظة في بداية العصر الكمبري للأرض - أي قبل نحو 550 مليون سنة - إلى الانفجار التطوري الذي ملأ البحار : بأولى الكائنات المعقدة في العالم " !!.. المصدر - “Mysteries of the Orient,” Discover, April 1993, p. 40, (emphasis added .. وأما فيليب جونسون Phillip Johnson الأستاذ بجامعة كاليفورنيا في بيركلي وأحد أبرز منتقدي الداروينية في العالم : فقد وصف التناقض بين هذه الحقيقة الحفرية وبين الداروينية بقوله : " تتنبأ النظرية الداروينية "بمخروط من التنوع المتزايد" عند تشكل أول كائن حي أو أول نوع حيواني .. تنوَّع بالتدريج وباستمرار : ليكوِّن المستويات العليا من الترتيب التصنيفي .. ولكن سجل الحفريات الحيواني الحقيقي أقرب إلى المخروط المقلوب رأسا على عقب !!.. حيث توجد الشعب في البداية : ثم تتناقص بعد ذلك " !!.. المصدر - “Darwinism’s Rules of Reasoning,” in Darwinism: Science or Philosophy by Buell Hearn, Foundation for Thought and Ethics, 1994, p. 12, (emphasis added .. وقد اعترف عالم المتحجرات الإنكليزي المشهور ديريك آجر Derek V. Ager بهذه الحقيقة على الرغم من كونه أحد دعاة التطور قائلاً : " تتمثل نقطة الخلاف في أننا إذا فحصنا سجل المتحجرات بالتفصيل : سواء على مستوى الترتيب أو الأنواع : فسنكتشف -مراراً وتكراراً- عدم وجود تطور تدريجي بل : انفجار فجائي لمجموعة واحدة على حساب الأخرى " !!.. المصدر - "The Nature of the Fossil Record", Proceedings of the British Geological Association, Vol 87, 1976, p. 133 .. ويعلق داع ٍآخر من دعاة التطور، هو عالم المتحجرات مارك سيزارنكي Mark Czarnecki على هذا الموضوع قائلاً : " إن المشكلة الأساسية في إثبات النظرية تكمن في سجل المتحجرات .. أي آثار الأنواع المنقرضة المحفوظة في التكوينات الجغرافية للأرض .. فلم يكشف هذا السجل قط أية آثار للأشكال المتوسطة التي افترضها دارون !! وعوضاً عن ذلك تظهر الأجناس وتختفي فجأة (يقصد الأجناس المنقرضة) .. ويدعم هذا الشذوذ حجة دعاة الخلق القائلة بأن الأنواع قد خلقها الله " !!.. المصدر - "The Revival of the Creationist Crusade", MacLean's, January 19, 1981, p. 56 .. ويقول أستاذ علم المتحجرات بجامعة غلاسكو نيفيل جورج T. Neville George : " لا داعي للاعتذار عن فقر سجل المتحجرات : فقد أصبح هذا السجل غنياً لدرجة يكاد يتعذر معها السيطرة عليه : وأصبح الاكتشاف فيه يسبق التكامل .. ومع ذلك : ما زال سجل المتحجرات يتكون بشكل أساسي من فجوات " !!.. المصدر - , "Fossils in Evolutionary Perspective", Science Progress, Vol 48, January 1960, pp .. وبالعودة لريتشارد موناسترسكي المحرر في مجلة علوم الأرض التي تعتبر إحدى داعيات التطور : بتوضيح ما يأتي عن الانفجار الكامبري الذي جاء بمثابة مفاجأة كبيرة لدعاة التطور : " قبل نصف بليون سنة ظهرت -فجأة- أشكال الحيوانات التي نراها اليوم : والتي تتسم بقدر لافت للنظر من التعقيد ..! وتعد هذه اللحظة عند بداية العصر الكامبري للأرض بالضبط - أي قبل حوالي 550 مليون سنة - علامة على الانفجار التطوري الذي ملأ البحور بأول كائنات معقدة في العالم ..!! وكانت شعب الحيوانات الكبيرة التي نراها اليوم : موجودة بالفعل في أوائل العصر الكامبري !!.. وكانت تتميز عن بعضها البعض بنفس القدر الذي تتميز به عن بعضها البعض اليوم " !!.. المصدر - Richard Monastersky, "Mysteries of the Orient", Discover, April 1993, p. 40
    ---------------

    58...
    فإذا تحدثنا عن معضلة التعقيد الذي ظهر في الأسماك مبكرا ! فمن المعلوم أن الأسماك قد ظهرت بتقديراتهم منذ 470 مليون سنة .. والسمكة التي سنأخذها كمثال الآن : هي سمكة الكويلاكانث Coelacanth .. والتي زعموا أن عمرها 70 مليون سنة فقط : وأنها الحلقة الوسطى بين الأسماك والكائنات البرية ! ثم انفضحت أكاذيبهم وخيالاتهم عندما تم اكتشاف أن هذه السمكة تعود لقرابة 410 مليون سنة ! وهو الزمن الذي كان التطوريون يفترضون فيه تخلف الكائنات الحية وبدائيتها !!.. فهل هي فعلا كذلك ؟! يقول عالم الحفريات التطوري بيتر فوري Peter Forey : " كان يحدوني الأمل في الحصول على معلومات مباشرة حول التحول من أسماك إلى برمائيات مع العثور على الكويلاكانث .. حيث إن الرأي القائل بأن هذه الأسماك قريبة من جد التتربود tetrapod : كان يلقى قبولا منذ فترة طويلة .. غير أن الدراسات التي أجريت على الأعضاء التشريحية للسمكة ووظائفها : أظهرت أن فرضية هذه العلاقة مجرد أمنية لا حقيقة ! وأن تقديم الكويلاكانث باعتبارها “الرابطة المفقودة “ : ليس له من سند " ! المصدر - Nature, Vol 336, 1988, p.7 .. ولقد صرّح هانز فريك Hans Fricke (وهو عالم الحيوان الألماني التطوري من معهد ماكس بلانك Max Planck) قائلا : " أعترف بأنني حزين ! لكننا لم نر الكويلاكانث في أي وقت ٍقط : وهي تمشي على زعانفها " ! المصدر - “ Coelacanth: The Fish That Time Forgot .. National Geographic , Vol.173, No. 6, June 1988, p. 838 بل وهناك معضلة أخرى قد شرحتها مجلة Focus حيث قالت : " وفقا للمعطيات العلمية : كانت جميع قارات الدنيا متصلة قبل 250 مليون سنة من عصرنا الراهن .. وقد أُطلق على هذه الكتلة اليابسة العظيمة “ بانجيا “ Pangea .. وكان يحيط بها محيط واحد وضخم .. وقبل حوالي 125 مليون سنة انشق المحيط الهندي : نتيجة لتعرض القارات للتزيح .. وقد ظهرت الكهوف البركانية الموجودة في المحيط الهندي (والتي تمثل جزءا هاماً من البيئات الطبيعية للكويلاكانث) بتأثير تزيح القارات هذا .. وعلى ضوء كل هذه المعطيات : تبدو أمامنا حقيقة أخرى هامة وهي : أن هذه الحيوانات التي وُجدت منذ نحو 400 مليون سنة : لم تتغير رغم كثير من التغيرات التي حدثت في البيئات الطبيعية " ! ويقول الأستاذ كيث س. تومسون Keith S. Thosom في كتابه (قصة الكويلاكانث) : " وعلى سبيل المثال .. كانت أقدم سمكة كويلاكانث معروفة تحوز العضو الروسترالي Rostral نفسه (يطلق علماء الحيوان على الكيس المملوء بمادة شبه هلامية والموجود داخل جمجمتها والأوعية الستة المرتبطة به اسم العضو الروسترالي) .. وكانت تحوز مفصلا ًخاصاً لجمجمتها وحبلاً ظهريا (notokord) وعددا قليلاً من الأسنان !!.. وهذا كله (ومثلما يبيّن أن المجموعة تكاد لم تمر بأي تغير على الإطلاق منذ العصر الديفوني منذ 400 مليون سنة) فإنه يكشف عن وجود فجوة هائلة بين السجلات الحفرية ! حيث أننا لا نملك سلسلة حفريات الأسلاف التي تبين ظهور السمات المشتركة التي تبدو لدى جميع أسماك الكويلاكانث " ! المصدر - Focus , April 2003 وإليكم معلومات معقدة جديدة أيضا ًتتعلق بالكويلاكانث ...! حيث لا تزال المعلومات الأخيرة المتعلقة بالبنية المعقدة للكويلاكانث : تشكل مشكلة بالنسبة للتطوريين ! يقول الأستاذ مايكل بروتون Michael Bruton فيما يتعلق بالسمات المعقدة المكتشفة للكويلاكانث : " إن الولادة : إحدى السمات المعقدة لهذه الكائنات !!.. فأسماك الكويلاكانث تلد ! حيث يتشقق بيضها الذي في حجم ثمرة البرتقال بينما هو لا يزال داخل السمكة ! علاوة على ذلك : فإن هناك اكتشافات حول تغذي الصغار من جسم الأم بفضل عضو شبيه بالمشيمة !!.. والمشيمة عضو معقد ! فهو إلى جانب توفيره الأكسجين والغذاء من الأم إلى الصغير : يقوم بإخراج المواد الزائدة عن حاجة التنفس والهضم من جسم الصغير ! وتبين حفريات الأجنَّة embriyo fosilleri (والتي ترجع إلى العصر الكربوني الفترة ما قبل 360 ـ 290 مليون سنة) : أن نظاماً معقدا ًكهذا وُجد قبل ظهور الثدييات بكثير " ! المصدر - Focus , April 2003 .. ومن جهة أخرى .. فقد ثبـت استشعار الكويلاكانث للمجالات الكهروماغنطيسية المحيطة بها ! الأمر الذي كشف عن وجود عضو إحساس معقد لدى هذا الكائن الحي ! وبالنظر إلى نظام الأعصاب الذي يربط العضو الروسترالي للسمكة بالمخ : يسلِّم العلماء بأن هذا العضو يقوم بمهمة استشعار المجالات الكهروماغنطيسية ! وحينما يتم تناول وجود هذا العضو الفعال (والموجود في أقدم حفريات الكويلاكانث والبنيات المعقدة الأخرى) بالدراسة : تظهر مشكلة ليس للتطوريين سبيل لحلها ! ألا وهي المشكلة التي أُشير إليها في مجلة Focus (البؤرة) كالتالي : " طبقا ًللحفريات : فإن تاريخ ظهور الأسماك يوافق ما قبل 470 مليون سنة من وقتنا الحالي .. أما ظهور الكويلاكانث : فبعد 60 مليون سنة من هذا التاريخ .. وظهور هذا المخلوق (والذي كان من المتوقع أن يكون ذا سمات بدائية للغاية) في بنية بالغة التعقيد : لهو أمر يثير الدهشة " ! المصدر - Focus , April 2003 .. وقد أثبتت الدراسات أيضا أن جميع الأسماك العظمية (Osteichthyes) (وباستثناء الكويلاكانث) : تسد احتياجاتها من الماء : بشرب ماء البحر : ثم تتخلص من الملح الزائد عن حاجة أجسامها .. أما النظام الموجود في جسم الكويلاكانث : فإنه يحاكي النظام الموجود لدى سمك القرش : والذي يندرج ضمن طبقة الأسماك الغضروفية (Chondrichthyes) ! والتي ظهرت في طبقة مختلفة تماماً ! المصدر -Focus , April 2003
    ---------------

    59...
    وأما المداخلة الأخيرة لي هنا : فهي عن معضلة تطور الإنسان من سلف شبيه بالقرود .. أقول .. رغم التباين الرهيب بين الإنسان وغيره من القرود والشيمبانزي وسلفه البعيد المزعوم : فإن التطوريون قد افترضوا سلسلة تطور له تبدأ كالآتي : 1- Australopithecus وهو القرد الأفريقي الجنوبي .. 2- Homo habilis وهو الإنسان مستخدم الأدوات .. 3- Homo erectus وهو الإنسان منتصب القامة .. 4- Homo sapiens وهو الإنسان العاقل والمعاصر .. أقول .. ولقد أثبتت الأبحاث أن الكائنات التي يمكنها أن تقف على أقدامها فترة ًقصيرة أو تمشي بها لعدة خطوات (كالدببة والقرود) : لا تستطيع تحمل هذا الوضع طويلا ً: لأن هيكلها العظمي والعضلي ليس مخلوقا ًلذلك !!.. ولذا : فسرعان ما ترجع لوضعها الطبيعي على قدميها ويديها مرةً أخرى !!.. وعلى هذا : فالمشي على قدمين في القرد مثلاً : يُعتبر عيبا ًوليس ميزة للاصطفاء الطبيعي لكي يتحول القرد إلى إنسان !!.. فإذا أضفنا إلى ذلك تغيير قدرات الأقدام الرهيبة للقرود في الإمساك : وتحولها لقدم بشر : لكان من الواجب (وحسب نظرية التطور نفسها) : أن يُفنيه الانتخاب الطبيعي لهذا العيب !!!.. إذ القرد وبهذه الصورة المعروفة لقدرات كفيه وقدميه : يستطيع العدو السريع والتخفي وتسلق الأشجار والقفز بينها : أفضل مما سيفعله الإنسان نفسه بالتأكيد إذا تغيرت يديه وكفيه بالطفرات إلى ما هي عليه الآن بمرور الزمن كما يزعمون !!.. ومن هنا : ولاستحالة الانتقال بين حركة القرد (أو السلف المشترك) المنحنية : وبين حركة الإنسان المستقيم القامة (واختلاف التركيب العظمي للحوض والقدمين إلخ إلخ بينهما) : فقد قام عالم الباليوأنثروبولوجيا الإنكليزي روبن كرومبتون : وبواسطة بحثه الذي أجراه بالحاسوب في عام 1996م إلى التوصل لأن مثل هذه المشية الانتقالية أو الوسطية المركّبة بين الأربعة أطراف منحنيا ً: وبين القدمين منتصبا ً: ليست ممكنة !!.. وخرج بالنتيجة التالية من بحثه : " إما أن يمشي الكائن الحي منتصب القامة : أو على أطرافه الأربعة كلها " !!.. وذلك بسبب فرط استهلاك الطاقة في مثل تلك المشية !!.. ولا تقتصر الفجوة الهائلة بين الإنسان والقرد السلفي المزعوم على شكل الكفين والقدمين أو المشي على أربعة أطراف فحسب : بل ما زالت هناك موضوعات تبحث عن تفسير مثل : سعة الدماغ .. والقدرة على الكلام .. والاختلاف في تركيب الأذن بينهما : إلى غير ذلك من الأمور التشريحية الكثيرة جدا ً!!!.. وتعترف بذلك إلين مورجان (وهي عالمة باليوأنثروبولوجيا وكانت من دعاة التطور السابقين إلى أن هداها الله) فتقول : " هناك أربعة أسرار : تعد من أبرز الأسرار التي تحيط بالبشر وهي : 1- لماذا يمشون على قدمين ؟ 2- لماذا فقدوا شعر الجسم ؟ 3- لماذا أصبحوا يملكون هذه الأدمغة الكبيرة ؟ 4- لماذا تعلّموا الكلام ؟ وتعد الأجوبة التقليدية لهذه الأسئلة هي : 1- نحن لا نعلم بعد ! 2- نحن لا نعلم بعد ! 3- نحن لا نعلم بعد ! 4- نحن لا نعلم بعد ! ويمكن أن تطول قائمة الأسئلة بشكل بارز : دون أن تتأثر رتابة الأجوبة " !!.. وأمام كل هذه المعضلات .. ولأن رأس مال التطوريين والملاحدة هو الكذب كما قالت مجلة العلوم الأمريكية في عدد يناير 1965م صراحة ً: " إن جميع علماء التطور : لا يتورعون عن اللجوء إلى أي شيء : لإثبات ما ليس لديهم عليه من دليل " !!!.. فقد لجأوا للعديد من الخدعات .. ورغم ذكري لبعضها من قبل .. إلا أني سأتحدث بشيء من التوضيح عن بعض الأمثلة الآن .. فهناك مثلا خدعة اللجوء إلى عظام بعض أنواع القردة الجنوبية أو الأفريقية : فيقولون عنها أنها كانت الإنسان البدائي ذو الأدوات (كالهومو هابيلج والأسترالوبيثاكينيچ) !!.. ثم يأتون في المقابل لأحد أجناس البشر والتي انساحت بين الشعوب قديما ً(كالنياندرتال) : ويصورونه على أنه أحد أجداد الإنسان المعاصر في التطور !!!.. والصواب (ومع مختلف الدراسات العلمية الحديثة) : فقد أثبتت التحاليل التي استندت إلى طبيعة وبنية تطور الأسنان : أن الأسترالوبيثاكينيچ والهومو هابيلچ : ينتميان إلى نفس أنماط القرود الأفريقية !!.. وأما تلك الخاصة بالإنسان منتصب القامة والإنسان النياندرتالي : فقد أشارت نفس البحوث إلى أنهما يملكان نفس تشريح الإنسان المعاصر ولكنه أقوى وأقصر قليلا ً !!.. ويُضاف لهذه الأبحاث أيضاً : والتي وصلت لنفس النتائج : أبحاث مختصي التشريح : فرد سبور .. وبرنارد وود .. وفرانز زونفيلد .. ولكن في هذه المرة عن طريق التحليل المقارن للقنوات شبه الدائرية الموجودة في الأذن الداخلية للإنسان والقرد والمسؤولة عن الحفاظ على التوازن .. حيث اختلفت قنوات الإنسان الذي يمشي منتصب القامة : اختلافاً كبيراً عن تلك الخاصة بالقرد الذي يمشي منحنياً إلى الأمام !!.. وفضلاً عن ذلك : جاءت نتائج تحليل قنوات الأذن الداخلية لكل القردة الجنوبية (الأسترالوبيثاكينيچ) وكذلك عينات الإنسان القادر على استخدام الأدوات (الهومو هابيلچ) التي حللها كل من سبور ووود وزونفيلد : جاءت كلها مماثلة لقنوات القردة العصرية !!.. أما فيما يتعلق بنتائج تحليل قنوات الأذن الداخلية للإنسان منتصب القامة : فقد أثبت التحليل أنها مماثلة لقنوات إنسان اليوم أيضاً !!..
    ---------------

    60...
    وأخيرا .. وفي نهاية هذه المناظرة من جانبي .. أذكر قول الله تعالى للإنسان الذي كرمه بالعقل وحرية الاختيار : فرفع شأنه على بقية الخلق بقوله في سورة الإسراء : " ولقد كرمنا بني آدم وحملناهم في البر والبحر ورزقناهم من الطيبات وفضلناهم على كثير ممن خلقنا تفضيلا " .. وقال عنه في سورة التين : " لقد خلقنا الإنسان في أحسن تقويم " .. ثم قال في سورة الانفطار لهذا الإنسان : " يا أيها الإنسان ما غرك بربك الكريم * الذي خلقك فسواك فعدلك * في أي صورة ما شاء ركبك " !!.. فسبحان الله العظيم ..

    وآخر دعوانا أن الحمد لله رب العالمين ..

    التعديل الأخير تم 03-16-2013 الساعة 06:50 PM

  13. افتراضي

    مشكور استاذنا ابوحب الله علي هذا الجهد العظيم اللذي قمت به بالنسبة لاتهامه لك بالتلفيق هي تهمة ساقطة ..واصلا هشام ادم نحن نعرفه معروف بالتلفيق والتدليس
    وساورد الادلة علي هذا بعد قليل نقلا عن البروف امين

  14. افتراضي

    سرقة رقم واحد :
    مقال عن الاعجاز العلمي في الشعر الجاهلي لهشام ادم في هذا الرابط
    http://www.sudaneseonline.com/cgi-bi...msg=1298729379
    سرقه من هذا الرابط بفصه ونصه
    http://www.######.org/debat/show.art.asp?aid=214055

  15. افتراضي

    سرقة رقم اثنين :
    في يوم 08/01/2008 فتح هشام آدم بوست بسودانيزاونلاين بعنوان تبسيط الفلسفة،
    والمقال تجدونه في هذا الرابط
    http://www.sudaneseonline.com/cgi-bi...msg=1239814102
    البوست مسروق تماما من كتاب ( مبادئ أولية في الفلسفة )لجورج بوليتزر :
    كما ستتضح من الصور
    انصتوا جيدا لهذه الصور وتعجب من هذا الملحد اللذي لا يتقي الطبيعة (الههم )
    الاتية

صفحة 1 من 3 123 الأخيرةالأخيرة

معلومات الموضوع

الأعضاء الذين يشاهدون هذا الموضوع

الذين يشاهدون الموضوع الآن: 1 (0 من الأعضاء و 1 زائر)

المواضيع المتشابهه

  1. إعلان: مناظرتي مع منكر السنة والتي انتهت بانسحابه ..
    بواسطة أبو حب الله في المنتدى قسم السنة وعلومها
    مشاركات: 17
    آخر مشاركة: 07-10-2019, 06:12 PM
  2. مناظرة: المناظرة التي انتهت بإفلاس حجج الإلحاد وهروب الملحد
    بواسطة elserdap في المنتدى قسم الحوار عن المذاهب الفكرية
    مشاركات: 26
    آخر مشاركة: 06-10-2013, 12:44 AM
  3. مناظرتي التي مزقت الملحد كل ممزق...
    بواسطة أحمد عبدالله. في المنتدى قسم الحوار عن المذاهب الفكرية
    مشاركات: 22
    آخر مشاركة: 06-01-2013, 06:30 AM
  4. جاري الملحد ... خاطرة بالتوكية - للأخ هشام بن الزبير
    بواسطة طالب العفو في المنتدى الصوتيات والمرئيات
    مشاركات: 3
    آخر مشاركة: 06-18-2010, 06:44 PM
  5. نساء انتهت صلاحية استخدامهن !!!
    بواسطة muslimah في المنتدى قسم المرأة المسلمة
    مشاركات: 0
    آخر مشاركة: 06-01-2009, 09:48 AM

Bookmarks

ضوابط المشاركة

  • لا تستطيع إضافة مواضيع جديدة
  • لا تستطيع الرد على المواضيع
  • لا تستطيع إرفاق ملفات
  • لا تستطيع تعديل مشاركاتك
  •  
شبكة اصداء