صفحة 9 من 18 الأولىالأولى ... 7891011 ... الأخيرةالأخيرة
النتائج 121 إلى 135 من 265

الموضوع: ما يجب أن تعرفه عن نظرية التطور البيولوجي (مجازا: نظرية داروين)

  1. #121
    تاريخ التسجيل
    Nov 2011
    الدولة
    المغرب
    المشاركات
    1,276
    المذهب أو العقيدة
    مسلم

    افتراضي

    اقتباس المشاركة الأصلية كتبت بواسطة أبو حب الله مشاهدة المشاركة
    ما شاء الله أختنا الفاضلة ....
    خير توطئة من متخصصة مثلك لمشاركتي القادمة بإذن الله تعالى وكما أخبرتك ...
    مع تنويه هام لإخواني وأخواتي وهو :
    هذا الموضوع ليس حكرا على أحد .. فمَن كان لديه ما يفيد في فضح تلك النظرية الساقطة :
    فليتقدم بما يعلم ....
    وفقني الله تعالى وإياكم إلى ما يحب ويرضى ....
    نحاول تقليدكم فقط أستاذنا الفاضل أبو حب الله ...وفقنا الله لما يحبه و يرضاه .
    " الصدق ربيع القلب ..و زكاة النفس ..و ثمرة المروءة .. و شعاع الضمير الحي.. ومناط الجزاء الالهي (هذا يوم ينفع الصادقين صدقهم ...) و إنَّ الضمائر الصحاح اصدق شهادة من الألسن الفصاح "
    -بتصرف-
    "حقُّ الواعِظ أن يتعظ ثمّ يعظ، ويبْصِر ثمّ يُبَصّر، ويهتدي ثم يَهدِي، ولا يكون دفترًا يُفيد ولا يستفيد، ومَسنًّا يحدُّ ولا يقطع، بل يكون كالشمس التي تُفيد القمرَ الضوء ولها أكثر مما تفيده"!
    -الراغب الأصفهاني رحمه الله-

  2. #122

    افتراضي


    متفرقات ....
    النسبة الذهبية : وحدة جمالية في مخلوقات الله !!

    الأخوة الكرام ...
    وقبل البدء في هذه الجولة الغريبة والعجيبة عن تواجد النسبة الذهبية في الخلية إلى المجرة :
    أود الإشارة أولا ًإلى شيء هام قد أشرت إليه سابقا ًوهو :
    ما يُعرف في علم الجينات الآن من تخصص عدد من الجينات في الكائنات الحية بـ :
    ضبط التماثل والتناظر (أفقي ورأسي وقطري) في عملية نمو الجسد : homeotic genes :
    Genes that control the development of an animal's body plan

    أي : ضبط عملية نمو الكائن الحي بحدوده الخارجية ونسب أطوال وأحجام أعضائه : Processes of growth ..
    ويشمل ذلك أيضا ًكسر التماثل لحكمة : مثل اختلاف وضع وتقسيمات وحجم الرئتين : وميل القلب بينهما إلى اليسار إلخ ...

    وهذه الجينات بمعلوماتها الغاية في الكمال والدقة : يستحيل أن تكون من عبث الطبيعة وصدفة التطور المزعومة ووليدة العشوائية والتجارب ولو لمليارات مليارات السنين !!..

    فتلك الجينات - وكما شبهتها من قبل - : هي لا وعي لها ولا عقل وإنما مجموعة ذرات وجزيئات : تقبع داخل الخلية الحية : ولا علم لها بالخارج - هذا لو كان هناك معنى أصلا ًلوصفها بالعلم وهي المادة الصماء العمياء - : والسؤال :
    كيف لمثلها أن يحكم بتكوين غاية في التكامل والدقة والتماثل إن وُجد : في جسسم وأعضاء الكائن الحي :
    حيوانا ًكان أو نباتا ً؟!!!..

    وحتى لا نطيل في هذه النقطة ولننتقل بعدها للحديث عن الجمال والنسبة الذهبية أقول :
    لنأخذ مثالا ًصغيرا ًوهو : تكون الجنين البشري كمثال ...

    حيث تخيلوا معي أن خلية ًواحدة : لا تمت للشكل الإنساني بتكوينه المعروف بصلة : سوف تصير إنسانا ً!!!..
    فهل لاحظتم كم وكثرة التغييرات التي يتطلبها ذلك حدوثا ًفي جسده داخليا ًوخارجيا ً؟!!..
    وذلك لأن الخلايا تتكاثر في كل اتجاه ولكن : يجب أن يكون ذلك تبعا ًلخطة محكمة موضوعة مسبقا ًومعلومة : لعدم تخطي تكاثر الخلايا لحدود الجسم الخارجية أو حدود كل عضو داخلي من الأعضاء بشكله وحجمه المعروفين !!.. أي يجب على الخلايا أن تعرف : متى تعمل على التكاثر : وفي أي اتجاه : ومتى تقف عن التكاثر بل : ومتى تقتل نفسها لتصنع تجويفات الجسم المعروفة في الإنسان !!.. وكل ذلك يتم طوال حياة الكائن الحي علمناه أو جهلناه !!!..

    فهناك خلايا تذهب مثلا ًلمكان الكبد : لتتكاثر مكونة ًالكبد فقط لا غيره !!.. وحتى عند موت خلاياه وولادة غيرها : تولد في نفس الأماكن ونفس المعلومات ولا تتخطاها !!..
    وهكذا خلايا المعدة والقلب إلخ .. وكل خلايا الجلد تتجدد باستمرار ولكن : في حدود نفس شكل جسمك ووجهك !!..
    أي أنك لو لم تقابل صديقا ًلعشر سنوات مثلا ً: ثم قابلته : فأنت تقابل جسدا ًجديدا ًبالفعل يختلف عن الذي قابلته من قبل !!..
    اللهم إلا بعض الاستثناءات في الخلايا مثل الخلايا العصبية ...
    والشاهد :
    هل تخيلتم أن كل ذلك مذكور في جينات الجنين الحاوية لتلك المؤثرات : للوصول إلى شكل جسده الآدمي المعلوم سابقا ًفي أحسن صورة ؟!!..
    هل تعلمون كم التعقيد للأحداث التي وقعت في جسد هذا الجنين الصغير طوال هذه الأيام ؟!!..

    هل يمكن لأي ملحد أو تطوري دارويني : أن يشرح لنا كيف تفسر نظرية التطور المزعومة : أن تقوم جينات الخلايا وفي وقت محدد : بقتل الخلايا لنفسها بنفسها مثلا ً: في المسافات التي بين الأصابع : لتظهر تلك الأصابع بعد ذلك بالشكل الذي نعرفه ؟!!..

    حيث يتم كل ذلك في انتظام وتناسق وتوقيت دقيق وبديع : لا يتأتى إلا من الخالق العليم الحكيم !!!..
    ولو كان الأمر صدفا ًوعشوائية :
    لكنا نرى معظم المخلوقات بتشوهات في أيديها وأرجلها مثلا ً!!!.. لتفاوت سرعة التكاثر وموت الخلايا وتفاوت التوقيت !!



    وهذه حكمة من الله تعالى في تشوهات الأجنة والمواليد التي نراها في البشر (طبعا ًالنسبة نادرة) :
    حيث سمح بوقوعها الله تعالى وربطها بأسباب لتؤثر على نمو الجنين (مثل تعرض المرأة الحامل للتدخين والإشعاع وبعض الأدوية إلخ) :
    لنرى بأنفسنا :
    ماذا يحدث إذا اختل النظام الدقيق لخلق الله تعالى وانتظام نمو كل كائن حي لإعطائه صورته وجماله :
    " ربنا الذي أعطى كل شيء ٍخَلقَه ُ: ثم هدى " !!.. فسبحان الله العظيم :

    < طبعا ًالمولودون بهذه التشوهات فهي من البلاء الذي يؤجرون على صبرهم فيه مثله مثل أي مرض يصيب الإنسان في حياته >

    ومثل تلك التشوهات التي شاهدناها بالأعلى : الأصل في حالة التطور المزعوم أنها تصير هي الغالبة والأكثر مشاهدة ًفي الكائنات !
    وذلك لأن التغيرات في الجينات صدفة ً: الأصل فيها أن تبقى صدفة : وألا تتوقف عن الصدفة لأنها لا تعقل ولا تعي !!..
    وليس للانتخاب الطبيعي أن يوقف الصدفة عن عملها يوما ً: إلا لو كان كما شبهته لكم من قبل : (السياف مسرور) !

    وقبل أن أترك هذه النقطة :
    سأذكر لكم نصا ًتعريفيا ًبسيطا ًوقصيرا ًعن مدى دقة عمليات نمو الكائن الحي بأوامر الجينات : والتي تتكسر عليها خرافات وأكاذيب التطوريين والداروينيين والملاحدة !!!... والترجمة من عندي مع بعض التصرف بالزيادة للتوضيح :

    Growth and development are controlled by a few different hormones in your body, such as human growth hormone.
    تتحكم مجموعة من الهرمونات المختلفة في عملية النمو وأطوار جسمك .. مثل هرمون النمو ..

    The production of these hormones is triggered by your genes when specific proteins are being produced.
    وتنتج هذه الهرمونات من جيناتك عن طريق بعض البروتينات المعينة التي تتحكم فيها ...

    Sometimes these triggers are an ongoing, lifelong process where other times these hormones are only turned on for a short period of time and then shut off.
    أحيانا ًهذه الهرمونات يتم إنتاجها طوال فترة العمر .. في حين بعض الهرمونات يتم إنتاجها وتفعيلها فقط لفترة قصيرة في حياة الكائن الحي : ثم تتوقف بعدها ..

    For example, HGH is something controlled by a feedback loop at all times. It controls when new cells need to be produced and hence growth will occur.
    كمثال : الـ HGH يتم بشكل دوري في جسم الإنسان طوال الوقت : وهو الذي يرصد الحاجة الدائمة لتوليد خلايا جديدة في الجسم لنموه ..

    When a baby is first conceived, there is a gene that will control if the baby becomes a boy or girl.... this is known as the SOX gene. If the SOX is activated, the baby will become a boy. If it is not activated, then it will become a girl. But this is a one time occurrence that happens at a specific time during development in the womb.
    وفي مقابل تلك العملية المتكررة للنمو : هناك ما يتم لمرة واحدة وفي فترة معينة ومحددة لا يتعداها .. ففي بدايات الجنين مثلا ً: هناك جين لتخصيص ما إذا كان هذا الجنين سيكون ذكرا ًأم أنثى .. ويعرف بجين SOX .. فإذا تم تفعيل هذا الجين : يصير الجنين ذكرا ًوتتحول أعضائه إلى الذكورة .. وإذا لم يتم تفعيله : يكون الجنين أنثى وتضمر وتتلاشى أعضاء الذكورة !!.. وكما نلاحظ : فهذه العملية قد جرت مرة واحدة فقط في حياة الكائن أو الإنسان وفي فترة معينة ومحددة بكل دقة !!..

    Other hormones include those involved in puberty. Although constantly being produced, their levels are controlled by these feedback mechanisms as well. Genes are what directs and controls these feedback loops through their protein synthesis.
    وتوجد هناك هرمونات أخرى تشمل فترة النمو في سن البلوغ .. وعلى الرغم من أنه يتم إنتاجها باستمرار وبصورة متكررة : إلا أن التحكم في مستوياتها يتم أيضا ًبهذه الآليات .. حيث الجينات هي التي توجه وتسيطر على هذا الاستمرار والتكرار من خلال عمليات تكوين البروتين ...
    -----

    وأعتذر لأني أكثرت عليكم في تلك المقدمة ولكن فقط :
    لتعلموا أنه لم يخلق الله تعالى شيئا ًفي هذا الكون عبثا ًولا هملا ً: وإنما كل شيء بدقة ونظام :
    " وكل شيء عنده بمقدار " !!..

    وذلك مهما زعم المغفلون والحاقدون من الصدفة والعشوائية والانتخاب الطبيعي والطفرات التي ألبسوها صفات الإله !
    والآن ...
    ننتقل إلى هذه الوحدة الجمالية والبُعد الجمالي في مخلوقات الله تعالى من داخل الخلية إلى المجرة :
    ألا وهي : النسبة الذهبية أو : فاي PHI كما يسمونها في الرياضيات مشتقة من اسم نحات مبنى البارثينون بأثينا : فيدياس ...
    ------
    -----------

    >> ما هي النسبة الذهبية Golden Proportion ؟!!!..



    في الصورة أعلاه : لدينا طول كلي وهو أ + ب .. وهو الذي باللون الأخضر ..
    ولدينا نسبة تقسيم بداخله إلى جزئين وهما : الجزء أ باللون الأزرق .. والجزء ب باللون الأحمر ..
    وهنا :
    فالحالة الوحيدة لهذا التقسيم : والتي يكون فيها نسبة الطول الكلي (أ + ب) إلى أ = نسبة طول أ إلى ب :
    تساوي : 1.618033988749894848 ... وهي قيمة الثابت فاي ...
    وهذه العلاقة في التقسيم لا يمكن تحقيقها : إلا بهذه النسبة الذهبية فقط ...

    بمعنى لو كانت القطعة أ مثلا ًتساوي ب : فإن الطول الكلي (أ + ب) إلى أ = 2 .. ولكن طول أ إلى ب = 1 ...
    والـ 2 طبعا ًلا تساوي الـ 1 ...

    ورغم معرفة قدامى مهندسي العالم في الحضارات القديمة لهذه المعلومة حسا ًوقياسا ً: وتطبيقهم لها في العديد من التطبيقات (كمباني المعابد والأهرامات والمساجد إلخ) : إلا أنه يُنسب للرياضي الإيطالي ليوناردو فيبوناتشي : وضع متتالية فيبوناتشي التي تعتمد على هذه النسبة ..
    < ملحوظة : هذه النسبة يمكن الحصول عليها أيضا ًبناتج قسمة (1 + جذر 5) / 2 > ...
    -------

    >> متتالية فيبوناتشي Fibonacci series ..

    حيث وضع ليوناردو فيبوناتشي (القرن الـ 13 الميلادي) المتتالية التالية للأرقام وهي عبارة عن جمع كل رقمين متتاليين فيها :

    فإذا بدأ بالصفر : فليجمعه مع الرقم الذي يليه وهو الواحد فيكون : 0 + 1 = 1 ..
    ثم يجمع الواحد على الرقم الذي سبقه وهو الواحد فيكون : 1 + 1 = 2 ..
    ثم يجمع الإثنين مع الرقم الذي سبقه وهو الواحد فيكون : 2 + 1 = 3 ..
    ثم يجمع الثلاثة مع الرقم الذي سبقه وهو الاثنين فيكون : 3 + 2 = 5 ..
    ثم يجمع الخمسة مع الرقم الذي سبقه وهو الثلاثة فيكون : 5 + 3 = 8 ..
    ثم يجمع الثمانية مع الرقم الذي سبقه وهو الخمسة فيكون : 8 + 5 = 13 ..
    وهكذا ...
    والغريب في هذه المتتالية :
    أن نسبة أي رقم فيها على الذي يليه : تساوي النسبة الذهبية = 1.618 !!!..
    وعلما ًبأن مقلوب النسبة هو = 0.618 !!!!..
    وإليكم الأرقام :

    0 - 1 - 1 - 2 - 3 - 5 - 8 - 13 - 21 - 34 - 55 ....... وهكذا ..

    ويمكن تمثيل هذه الأرقام عن طريق رسم مربعات : كل مربع يمثل رقم منها ... وذلك كالصورة التالية :



    حيث نبدأ برسم مربع 1 * 1 .. ثم جواره مربع آخر 1 * 1 .. ثم مربع فوقهما 2 * 2 ..
    وهذه المربعات لن تجدوا أرقامها في الصورة أعلاه لصغر حجمها ..
    ثم مربع على يمينهم 3 * 3 .. ثم مربع أسفلهم : 5 * 5 .. ثم مربع يسارهم 8 * 8 .. ثم مربع اعلاهم 13 * 13 .. ثم مربع يمينهم 21 * 21 .. ثم مربع أسفلهم 34 * 34 .. ثم مربع يسارهم 55 * 55 وهكذا ...

    ومن هنا كانت أجمل نسبة للمستطيل : هي مستطيل النسبة الذهبية :

    يعني المستطيل مثلا ًالذي فيه كما ترون بالأعلى المربع 1 والمربع 1 ومعهما المربع 2 ..
    فالثلاثة مربعات يكونون معا ًأجمل نسبة مستطيل هندسيا ًوترتاح لها العين !!!..
    ومثله المستطيل المكون مثلا ًمن المربعات : 1 و 1 و2 و 3 .. وهكذا ...
    وهو الذي اعتمد عليه المعماريون قديما ًفي مبانيهم : وحديثا ًكالمعماريين الشهيرين لوكوربوزيه وماريو بوتا ..

    فمن القديم مثل الأهرامات في الجيزة :



    ومعبد البارثينون بأثينا :



    وجامع القيروان الكبير أو جامع عقبة بن نافع في معظم أرجائه من المساحة الكلية إلى مساحة فناء المسجد وحتى في منارته ..



    وتاج محل بالهند :



    ومبنى عصابة الأمم المتحدة :



    وقد تم صنع فرجار خصيصا ًGOLDEN MEAN GAUGE : مضبوطا ًعلى قياس النسبة الذهبية :



    ويمكن استخدامه في قياس نسبة العديد من الأشياء من حولنا وحتى من الصور :







    بل ويتعدى جمال النسبة الذهبية في الأطوال المكانية : إلى جمال الأطوال الصوتية !!!..
    < وسبحان مَن غرز في فطرتنا وفطرة الكائنات الحية الانجذاب لتلك النسب حتى ولو لم نعرف تلك التفاصيل >

    فحتى ضربات القلب كمسافات زمنية وأيضا ًبعد تمثيلها بيانيا ً: تتماشى علاقاتها مع النسبة الذهبية :



    وبلغ الاعتداد بتلك النسبة ودلالاتها وتأثيرات جمالها : أن تم عمل البعد بين أوتار بعض الآلات الموسيقية على نسبتها !!..
    بل :
    وتم اعتماد متتالية فيبوناتشى على الجداول البيانية التحليلية في الفوركس !!..
    ويسمونها : نسب الفيبو ...
    حيث يستخدم مؤشر فيبوناتشي (Fibonacci Retracement Level أو بأختصار Fib) لمعرفة مستويات الدعم والمقاومة !!.. حيث يرشد المتداولين لنقاط مستويات الدعم والمقاومة وحيث تحمل قيمها معلومات هامة لذوي الخبرة : وكذلك لتجار الفوركس المبتدئين لأنها تساعدهم على تحديد نقاط الدخول والخروج خلال التجارة ...!

    والغريب :
    أننا لو قمنا برسم ربع دائرة بداخل كل مربع بنفس الترتيب والاتجاه السابق :
    سيتكون لدينا ما يُعرف بـ :
    -------

    >> اللولب الذهبي Golden Spiral ...

    حيث سنرسم ربع دائرة في كل مربع من المتتالية : وصولا ًإلى المربع الذي بطول 13 * 13 مثلا ً: وذلك لنرى المنحنى التالي :



    وهو ليس لولبا ًرياضيا ًتماما ً: وذلك لأنه مكون من أكثر من منحنى ...
    ولكنه يماثل - ويا لغرابة الملحدين - : الشكل الحلزوني المميز في الكائنات الصدفية مثل الحلزونات والأصداف البحرية !!!..
    بل ونرى فيهم أيضا ًأن نسبة قطر كل التفاف لولبي إلى التفاف اللولب الذي يليه هو 1.618 أيضا ً!!..



    بل وحتى في قرون بعض أنواع الماعز والغزلان !!!..
    بل وأيضا ًفي أذن الإنسان :



    بل وأحد أروع الأمثلة على ظهور متتالية فابوناتشي بالنسبة الذهبية في الطبيعة : يمكن رصده في زهرة تباع الشمس !!..
    حيث قام العلماء بقياس عدة حلزونيات داخل الزهرة : ووجدوا أنه ليس مجموعة واحد فقط من الحلزونات تسير باتجاه عقارب الساعة انطلاقاً من المركز : بل هناك مجموعة أخرى تسير بعكس عقارب الساعة كما في الصورة التالية :



    وهاتان المجموعتان الحلزونيتان : كشفتا عن صلة مذهلة بمتتالية فابوناتشي !!.. حيث وجدوا أن كلا ًمن هاتين المجموعتين تحتويان على مسارات حلزونية يكون عددها : متطابق مع رقمين متتاليين من متتالية فابوناتشي !!!.. فمثلاً : إذا كان عدد المسارات في المجموعة الأولى 21 ‏مساراً : فوجب أن يكون في المجموعة الثانية 34 ‏مساراً !!!..
    وهناك أزهار أخرى تحتوي مجموعتيها على 34 و 55 ‏مسار !!!.. أي يمكن أن يختلف عدد المسارات الحلزونية بين زهرة وأخرى ولكن المهم : أن يكون عدد المسار في مجموعتي كل زهرة : متطابق مع رقمين متتاليين في متتالية فابوناتشي !!!..

    وكذلك أيضا ًثمرة الصنوبر أو الأقحوان أو الأناناس : فإن تعداد مجموعتي المسارات الحلزونية في هذه الثمرة : يبين أن عدد كل مجموعة هو الآخر : يتوافق مع رقمين متتاليين في متتالية فابوناتشي !!..
    كما اكتشف علماء الأحياء أن نسبة قطر كل التفاف وآخر يليه في أكواز الصنوبر هو 1.618 أيضاْ !!..

    والفيديو التالي فيه توضيح أكثر لما نقصده هنا : حيث سيتم تلوين عدد كل اتجاه حلزوني بلون :
    فيخرج أحدهما بعدد 8 .. والآخر 13 .. وأعتذر عن الموسيقى في المقطع : وإن تم خفض الصوت للآخر يكون أفضل : فليس هناك كلام أصلا ً:



    بل وحتى النباتات التي لا يتوافق توزيع أوراقها ولا ثمارها مع متتالية فابوناتشي : فإننا إذا دققنا جيداً : فسوف نلاحظ وجود هذا المبدأ ولكن في مكان آخر !!.. مثل مثلا ً: عدد تفريعات السيقان أو الأغصان !!.. فكما هو موضح في الشكل التالي في نبتة "عود العطاس" مثلاً :



    فعلى اليمين : نجد مراحل تفرع سيقان النبات منذ بداية نمو النبات من أسفل إلى أعلى (6 مراحل) .. فنجد التالي :
    في التفرع رقم 1 من أسفل : يوجد 1 ساق فقط ...
    في التفرع رقم 2 : يوجد 1 ساق أيضا ً..
    في التفرع رقم 3 : يوجد 2 ساق ..
    في التفرع رقم 4 : يوجد 3 ساق ..
    في التفرع رقم 5 : يوجد 5 ساق ..
    في التفرع رقم 6 : يوجد 8 ساق ..
    وحتى في التفرع الأخير الذي يليه والذي فيه الزهور البيضاء : يوجد 13 ساق لو لاحظتم ..!!!

    بل وحتى في شكل وعدد البتلات المتراكبة في الزهرة الواحدة كما في الفيديو التالي (أيضا ً8 و 13 في الاتجاهين) :



    ولشدة وجود هذه النسب الظاهرة بوضوح في معظم النباتات .. فقد تم تناولها من خلال علم "الفيلوتاكسيس" Phylotaxis .. وهو علم يبحث في توزيع الأوراق والبذور في النباتات ..
    حيث تم ملاحظة متتالية فابوناتشي في طريقة توزيع الأوراق والبذور من خلال ثلاث وضعيات حلزونية وهي :
    1- وضعية رأسية :
    حيث تستعرض الأوراق متتالية فابو ناتشى خلال نموها صعوداً على الساق ..
    2 - وضعية أفقية :
    حيث تستعرض البذور متتالية فابوناتشي خلال نموها الأفقي و كما في حالة عباد الشمس ...
    3 ‏- وضعية مخروطية أو دائرية :
    وهو كما في ثمرة الصنوبر أو زهرة الأقحوان أو ثمرة الأناناس .. حيث تظهر مجموعتان من المسارات الحلزونية ..

    والحاصل :
    أنك في كل كائن حي تقريبا ً: يجب أن تلحظ في خلقته المثالية :
    مظهرا ًمن مظاهر النسبة الذهبية أو متتالية فابوناتشي وأرقامها ونسبها هنا أو هناك :



    بل من أصغر مكونات في الخلية :
    تجد النسبة بين الدوامتين المتشابكتين فى الحمض النووى DNA تساوي 1.618 بين العرض وارتفاع الحلقة !!!!..



    وحتى أِشكال المجرات الضخمة في الكون : تحمل انحناءات أذرعها ونسبها : النسبة الذهبية !!!!..


    --------

    >> مظاهر أخرى كثيرة ....

    ولن أتحدث هنا عن تطبيقات البشر العديدة لهذه النسبة الجمالية :
    سواء في اعتمادهم عليها في الصور الفوتوغرافية الدعائية : أو في اللوحات المرسومة :
    أو في اعتماد نسبة المستطيل الذهبي كأفضل نسبة للبطاقات والكروت !!..

    بل سأتحدث هنا عن وجودها في مخلوقات الله تعالى نفسها بصورة غريبة وعجيبة !!!!..
    فمثلا ً:
    اكتشف علماء البيولوجيا خاصية غريبة تتعلق بمجتمعات النحل ألا وهي :
    أن عدد الإناث في أي خلية : يفوق عدد الذكور بنسبة ثابتة وهذه النسبة هي 1.618 !!!..

    وهناك ما يعرف لدى العلماء أيضا ًبالمثلث الذهبي (وهو مثلث متساوي الساقين زاوية رأسه = 36 ويمكن تقسيمه لمثلثات ذهبية أصغر بنفس النسب) ..

    ونجد أن الشكل الخماسي المنتظم والذي تتخذه مثلا ًكريستالات الماء الصغيرة يحتوي على علاقات ومثلثات ذهبية بداخله (المثلثات الداخلية الواصلة بين الرؤوس) ..!
    ------

    >> النسبة الذهبية في جسم الإنسان ..

    وأما تلك النسبة الجمالية في جسم الإنسان وأعضائه عموما ً- في الحالة المثالية - : فحدث ولا حرج !!..
    وقد علم النحاتون الرومانيون واليونانيون ذلك قديما ً: فاعتمدوه في تماثيل البشر والآلهة المزعومة لديهم : لإكسابها الجمال القياسي !!...

    فالنسبة مثلا ًبين المسافة من قمة رأسك إلى الأرض : والمسافة من سرة بطنك إلى الأرض : تساوي 1.618 !!..
    ولو قست المسافة بين كتفيك وأطراف أصابعك : ثم قسمت الناتج على المسافة بين كوعك وأطراف أصابعك : نفس النسبة !



    وأيضا ًالمسافة بين الورك إلى الأرض : مقسمة على المسافة بين الركبة والأرض : تعطيك نفس النسبة الذهبية !
    وحتى الوجه نفسه : فطول الرأس بأكملها إلى عرضها : نفس النسبة الجمالية ..!
    بالإضافة لعلاقات عديدة داخل الوجه تجسد هذه النسبة الجمالية فيها إن تحققت أو معظمها :



    وأيضا ًفي أيدينا ونزولا ًحتى أطراف الأصابع :


    ---------

    >> وماذا أيضا ً؟؟؟..

    عندما تم الإعلان عن وجود سفينة نوح عليه السلام فوق جبل الجودي ...
    وتم رصد جسمها وتكويناتها الخشبية ومساميرها إلخ ...
    تعجب الباحثون أشد العجب : أنهم وجدوا في إنحناءاتها النسب الهندسية الأشهر مثل الباي والفاي !!!..
    وسبب التعجب الشديد هو : عدم توقعهم معرفة البشر في هذا الزمن السحيق لتلك النسب أصلا ً!!!..



    فسبحان القائل سبحانه لنوح عليه السلام : " واصنع الفلك : بأعيننا ووحينا " !!!..

    وأما الأعجب والأعجب :
    فهو أنه بالبحث في مجسم كوكب الأرض عن نقطة تجسد النسبة الذهبية ...
    وجدوا مكة تجسدها طولا ًوعرضا ًبين أرض العالم !!..

    وأترككم مع الفيديو الأول : وفي أوله وقبل الحديث عن مكة : تجدون قياسات كثيرة بالنسبة الذهبية في جسم الإنسان :
    وأعتذر أيضا ًعن الموسيقى .. وعن وجوه النساء الجرافيك فيه وأجسام الرجال لبيان النسبة الذهبية فيهم :
    مع التنبيه إلى أن الفيلم معكوس لأنه أجنبي في الأصل : فالطواف حول الكعبة ستجدونه معكوسا ً:



    ولأن الكثير من الحاقدين حاولوا التشويش على تلك الحقيقة والتشكيك والطعن فيها :
    فقام أحد الأخوة بعمل هذا الفيديو أيضا ًباستخدام برنامج فلاش وبعض البرامج المساحية الأخرى :



    فسبحان الواحد الأحد ...!

    والسؤال الآن لكل ملحد أو تطوري دارويني عبد الصدفة والعشوائية :

    هل كل ما رأيته وقرأته وشاهدته الآن : صدفة ؟!!!..
    لا ...
    طيب .. وهل إذا حدثت الصدفة مرة : هل هناك ما يُلزمها على التثبيت والتكرار ؟!!..
    لا ...
    حسنا ً.. وهل يمكن نسبة كل تلك الأشياء إلى أي قانون تعرفه ؟!!!..
    هل هناك قانون يُلزم الأطوال أو الأصوات أو النسب من لولب الحمض النووي إلى أذرع المجرة :
    على التزام النسبة الذهبية ؟!!!.. هل ستهلك الموجودات أو تموت الكائنات الحية لو لم توجد بها تلك النسبة ؟!!..
    لا ...
    جميل .. وهل تعي أو تفهم : أنك لو أرجعت كل ذلك للصدفة (ولنأخذ نسب جسم الإنسان كمثال) :
    هل تعي أو تفهم كم يتطلب الأمر مليارات المحاولات والنسب والتظبيطات للوصول لنسب جسمنا الذي نحن عليها الآن ؟!!..
    ألا ترى أن ذلك لم يزد الطين إلا بلة بخصوص خرافة التطور الصدفي العشوائي في إيجاد الكون وما فيه ؟!!!..
    وأنك لم تفعل إلا أن أضفت مستحيلا ًإلى مستحيل !!!..

    وسؤال أخير :
    ألا ترى بعد كل ذلك أن وحدة النسبة الذهبية : هي علامة كونية مثلها مثلا ًمثل الرقم 7 :
    والذي يتكرر في العديد من مظاهر الكون ونصوص الدين على حد سواء : وبصورة ملفتة لنظر كل عاقل ؟!!!..

    يُـتبع بإذن الله تعالى بالحديث عن التصميم الذكي : ومحاولات التطوريين للتملص منه ...
    والله المستعان ..
    التعديل الأخير تم 07-12-2012 الساعة 09:34 AM

  3. #123

    افتراضي


    متفرقات :
    خرافة استطالة عنق الزرافة : وأشياء أخرى ..

    -----

    الأخوة الكرام ...
    في أثناء إعدادي للمشاركات عن التصميم الذكي كما وعدت :
    راسلني أحد الأخوة في منتدى أنصار السنة بتعليق مهذب :
    يحاول فيه تصحيح رؤية التطوريين عن تطور الزراف : عن طريق الانتخاب الطبيعي لصفة طول العنق ..
    فرددت عليه بنقل إحدى مشاركاتي هنا مع الأخ عبد الحق لضيق الوقت مع بعض التصرف اليسير ..
    فاستدرك على ردي ..
    فكتبت له ردا ًساعتها .. ورأيت عرض الردين هنا للفائدة ...
    وإلى حين صدور بداية مشاركات موضوع التصميم الذكي بإذن الله تعالى - ربما بعد رمضان -
    وأترككم مع النقل ...
    ------

    أهلا ًبك أخ عادل ...
    واعذرني على تأخر الرد للانشغال الشديد والله ..
    فلم أر سؤالك بطريقة إعلام الإيميل إلا اليوم من وسط عشرت الإيميلات ..
    أنت تقول :

    أولاً أحب أن أشيد بالموضوع والمجهود الذي بذلته في إعداده،
    واتمنى أن نستفيد من هذا الموضوع الشيق.
    أما فيما يتعلق بالرد على مثال الزرافة، وتوريث الصفات المكتسبة، فنظرية التطور لا تقول إن الصفات المكتسبة تورث ولكن الطبيعة تنتخب الصفات المفضلة لنتقلها للجيل اللاحق.
    ففي مثال الزرافة يكون ترتيب الأحداث على النحو التالي:
    1. تقضي الزرافة ذات العنق القصير على الموارد الغذائية في مدى طول عنقها.
    2. الجيل اللاحق من الزرافة لا يجد طريقة للغذاء لأن الموارد التي يمكن أن يصل إليها بعنق قصير نفذت.
    3. تبدأ الزرافات ذات الأعناق القصيرة في الانقراض بناءً على مفقدان المورد.
    4. هنا يأتي دور التمتيز، حيث يصدف أن تظهر زرافة عنقها أطول (قليلاً) من بقية الزرافات.
    5. هذه الزرافة تحصل على فرصة في البقاء وفرصة لتمرير جيناتها للجيل اللاحق.
    وبعد تتابع هذه العملية لعدة أجيال، يصبح من الممكن أن يطول عنق الزرافة بالتمايز وليس بتوريث الصفات المكتسبة.

    أقول :
    كلامك ذلك ذكرني بسؤال أجبت عليه منذ فترة لأحد الأخوة في منتدى التوحيد اسمه عبد الحق ..
    وإليك نقل إجابتي عليه هنا :
    مع مراعاة التشابه بين كلامي عن الغزال : وبين الزراف القصير القامة المفترض أنه جد الزراف الحالي ..

    عندي سؤال إضافي
    يقولون أن الزرافة قامت بإطالة عنقها لأن الأشجار كانت عالية!!!!

    مثل هذا الكلام الخرافي :
    قد نشأ بداية ًعلى فرضية تشابه الحيوانات التي - من المفترض - أنها تطورت من بعضها البعض ..!!
    فجاء مثل هذا الكلام المتهافت لتفسير كيفية تحول الأقدم في شجرة التطور إلى الأحدث ...

    وللعلم :
    ما زال هناك من علماء التطور مَن يلجأ لمثل هذه الخزعبلات في تفسيره لتطور الكائنات الحية !!!!..
    فكما يقولون بتطور الغزال إلى زراف بسبب مداومته على مد عنقه لأعالي الأشجار :
    قالوا أيضا ًبظهور الأيدي والأرجل في الأسماك نتيجة زحفها في الوحل والطين لتتحول بذلك إلى زواحف أو برمائيات !!..
    وهكذا ...
    وهو ما يستحي من ذكره صراحة أكثرهم اليوم : ولكن يستعيضون عنه بكلمات مثل :
    تكيف الحيوان مع بيئته .. تحورات بيئية ... إلخ
    وبالطبع : كل ذلك يمكن نقضه ونقده بأبسط قواعد المنطق أيضا ًكما في سؤالك الأول ....
    ويمكنك أن تعد معي النقاط التالية - متخذا ًحالة الغزال وتطوره إلى زراف كمثال - :

    1...
    بفرض أن عنق غزالة قد استطال بالفعل في حياتها من كثرة ما قامت بمده لأعالي الأشجار :
    فإنه من المعلوم أن ما يكتسبه الكائن الحي في حياته من صفات جسدية :
    لا يتم توريثه أبدا ًإلى الأبناء !!!!!..

    فالنجار والحداد ذوي العضلات المفتولة بسبب طبيعة عمليهما : لا يرث أبناؤهما المولودين هذه القوة والعضلات !!..
    بل ومن أبرز وأشهر الأمثلة أيضا ًعلى ذلك : هم شعب الكايان !!!..
    حيث منذ سن الخامسة تبدأ الفتاة عندهم بوضع طوق حول رقبتها .. وكل فترة تضيف طوقا ًجديدا ً!!!..
    وبمرور الوقت تستطيل رقبة النساء كما في الصورة التالية - قد انتقيت صور نساء كبار السن لعل الإشراف لا يحذفها -



    والسؤال الآن هو :
    إذا كانت نظرية الزرافة صحيحة في استطالة عنقها من الغزال :
    فلماذا يولد أبناء شعب الكايان في كل مرة برقبة عادية : ولا علاقة لها البتة بشكل وطول رقاب أمهاتهم ؟!!..
    وهذا أيضا ًما أثبته أحد علماء التطور نفسه عندما قام بقطع ذيول فئران تجارب لعشرات الأجيال :
    فإذا بها في كل جيل تولد بذيول من جديد !!!..
    < والعالم هو الألماني فايزمان وقطع ذيول 19 جيلا من الفئران بما يوازي 570 عام من عمر البشر !! >

    2...
    أي تغيير محسوب ومتكامل ودقيق في جسم الكائن الحي :
    يجب أن يبدأ من جيناته الوراثية أولا ً: والتي تحمل كل تفاصيل جسده !!!!...
    وبمعنى آخر أكثر سهولة : يمكننا سؤال أنفسنا :
    كم من التغييرات والمعجزات الخـَلقية يتطلبها تطويل عنق الزرافة ؟!!..

    حيث يجب أن تقع عدة تغييرات في وقت واحد : وتتكامل مع بعضها البعض وكأنها تعي وترى وتعرف ماذا تفعل !!..
    فنحتاج مثلا ًتغييرات في عظام العنق واستطالتها .. ثم العضلات التي ستحمل هذا الوزن الجديد والثقيل للعنق ..
    ثم أهم وأعجب ما في ذلك كله - والذي يدلنا على الخلق الخاص للزراف كما أراده الله عز وجل - ألا وهو :
    كيفية وصول الدم إلى مخ الزرافة ؟!!!..
    فللزرافة قلب كبير : يستطيع ضخ الدم إلى هذا المخ رغم ارتفاعه فوق مستوى القلب بحوالي ثلاثة أمتار!!!..



    حيث حتى مع افتراض أن ضغط دم الزرافة من القوة بحيث يتغلب علي الجاذبية الأرضية فيصل إلى المخ :
    فإن هذا الضغط كفيل أيضا ً- نظريا ً- بتفجير الأوعية الدموية الرقيقة في العين والمخ نفسه !!!..
    أو حتى دفع الدم إلى الخارج في حالة الاسترخاء أو إنزال الرأس !!!..
    وكل ذلك لا يحدث .. بل تحيا الزرافة حياتها بكل حرية وتلقائية بغير خوف من هذه المسألة إطلاقا ً!!!..
    فالأمر ليس بهذه السذاجة ولا السطحية التي يُصورونها للبلهاء في سيناريو استطالة عنق الزرافة !!!!..
    والله الشافي ...

    3...
    وأما إذا جئنا لمنطقك أخي عبد الحق في نقد ونقض فكرة تطور الزرافة هذه ...
    فاسمح لي أن أ ُجاريك في نفس تفكيرك أيضا ًفأقول :

    4...
    معلوم أن الغزال وقبل أن تطول رقبته : فهو يستطيع أكل نباتات وحشائش أرضية أو في مستوى قامته !!..
    بمعنى آخر : ليست الحاجة ماسة وحاسمة لتناول طعامه من أعلي الأشجار ...!!
    والدليل : أن هناك أنواع عديدة من الغزال إلى اليوم : لا زالت تحيا في نفس بيئتها لم تتغير ولم تستطيل أعناقها !!!..





    5...
    ولو كان هناك أي داعي لاستطالة عنق الغزال :
    لكان أولى أنواع الغزال بذلك هو غزال الجيرنوك Gerenuk .. أو ما يسمى في أفريقيا بـ الغزال الزراف !!!..
    وتحديدا ًفي الصومال وتنزانيا وأثيوبيا وجنوب كينيا !!!!..



    حيث نرى الأنثى في يمين الصورة .. والذكر في اليسار .. وإليكم صورتين من قريب للذكر ثم الأنثى على التوالي :





    فرغم مده لعنقه دوما ً: إلا أنه لم يتحول يوما إلى زراف !!!!...
    < يذكرني بالسمك الطائر والشهير بقفزه طيرانا ًمن الماء ثم العودة إليه : والذي لم يتحول يوما ًإلى طير ! >

    وصراحة ًلو افترضنا جدلا ً- جدلا ًفقط - صحة نظرية استطالة عنق الزرافة :
    لكان الأولى بهذا النوع من الغزال وبدلا ًمن أن تستطيل أعناقه : أن يصير حيوانا ًيقف على قدميه !!!!..
    فذلك هو الأقرب للمنطق ساعتها ولواقع هذه الحيوانات !!!!.. وانظروا الصور :







    6...
    نقطة هامة أخرى وهي أن التغير الخيالي المطلوب في عنق الزرافة نتيجة مدها لعنقها :
    فلن يتم بين يوم وليلة ..
    ولا حتى في مئات وآلاف السنين !!..
    < فها نحن منذ آلاف السنين لم نر كائنا ًيتطور !!.. ولم يطول عنق غزال ولا زرافة ولو زيادة صغيرة >

    والسؤال :
    باعتراف التطوريين أنفسهم : أن ذلك التغيير يتطلب ربما ملايين السنين ..
    وحتى يأخذ الانتخاب الطبيعي المزعوم مجراه (السياف مسرور) والسؤال :
    هل المنطقي طوال هذه الفترة المهولة الكبيرة :
    وإذا كان الغزال أو حتى جد الزراف يتناول طعامه من نباتات الأرض :
    أنه إذا حدث جدب في منطقة : ألا ينتقل إلى أخرى في هجرات جماعية كما نرى اليوم ؟!!!..
    أليس هذا هو التصرف الطبيعي المقبول بدلا ًمن افتراضات التطور الخرافية ؟!!..
    وحتى لو قيل أن جد الزراف لم يكن يتناول نباتات الأرض بل الأشجار القصيرة والمتوسطة ..
    أقول :

    ولماذا قضى الجدب على الأشجار القصيرة والمتوسطة وترك الطويلة فقط ؟!!..
    ألا ترون أن في ذلك افتعالا ملحوظا ًلكي تستقيم لكم فكرة الانتخاب الطبيعي في مجراها في خطتكم ؟!
    لماذا لم ينتقل الزراف لمكان آخر بحثا ًعن شجر قصير ومتوسط - وما أكثره - ؟!!..
    أليس هذا أسهل من خزعبلات التطور ؟!!!..

    7...
    سؤال وجيه آخر وهو :
    أنتم افترضتم ظهور صفات طول عنق الزراف : وأن الانتخاب الطبيعي اختارها واستبقاها ..
    إذن : فلماذا لا نرى زرافا ًقصير القامة أصلا ً- وكصفة أصلية كانت في الزراف يوما ًما - ؟!!..
    حتى ولو لن يختارها الانتخاب الطبيعي ولكن :
    أين هي ؟!!!..

    لأنه لو صحت فكرتكم :
    فلو أحضرنا زرافا ًفي منطقة شجر قصير ومتوسط : واستمر الزراف في انحناء عنقه لأسفل :
    فمن المفترض أن يكون في ذلك ظهورا ًوسيادة ًلصفة قصر طول قامة الزراف من جديد ..
    ولكن - وكما قلت - :
    أين هي أصلا ً؟!!!!!..

    8...
    وأما مسك الختام في مثل هذا التفكير المنطقي البسيط لنقد ونقض هذه الفكرة عن استطالة عنق الزراف :
    فأتساءل :
    هل الأهم في حياة الكائن الحي : أكل الطعام ؟.. أم شرب الماء ؟..
    فإن قالوا شرب الماء كما هو معلوم علميا ً:
    أقول :
    إذا ً: على أرجل الزرافة أن تقصر في الطول من جديد !!!!..

    لأن حركتها الشاقة عند شربها للماء : هي أولى في التغيير من استطالة رقبتها للأكل من أعالي الأشجار !!!..
    وخصوصا ًوأن معظم حالات افتراسها - سواء من الإنسان أو الحيوانات الأخرى كالأسد - هي أثناء ذلك الوضع تحديدا ً!
    وانظروا أيضا ًمعي للصور :





    وأكتفي بهذا القدر ....
    والله الموفق ..
    -------------------

    كان هذا هو ردي الأول على مشاركته .. وإليكم الرد على مشاركته الثانية للفائدة :

    ------------------

    لك مني الود والتقدير والاحترام
    ولك أيضا ً...
    ولأن الجواب الماضي كان للأخ عبد الحق ...
    فإليك جوابا ًخاصا ًبك أخي الكريم ...
    حيث أرى أنك لديك بعض المعلومات الخاطئة للأسف مما ينشره التطوريون ...
    فأنت قلت :

    1 .دراسة نظرية التطور لم تعتمد فقط على التشابه الظاهري بين الكائنات الحية

    لا .. هي تعتمد على ذلك بالفعل ..
    بل هو أول ما لفت الأنظار إلى فكرة تطور الكائنات من بعضها البعض ..!
    وعلى هذا سعى داروين لوضع (تفسيرات) لذلك : أو إيجاد دلائل عليه :
    فكان اتجاهه للتهجين البشري وما ينتج عنه .. وسوف يأتي الحديث عنه بعد قليل ...

    ولكن اعتمدت على صفات أخرى أكثر تعقيداً مثل أن يكون هناك كائن بحري له رئة مثل الحوت.

    الحوت حيوان ثديي وإن كان يعيش في البحر .. وهو يلد ويُرضع صغاره ويتنفس الهواء من الرئتين ..
    ونحن نؤمن بأن الله تعالى له طلاقة القدرة على خلق ما يريد أينما شاء ..
    فيخلق البلاتيبوس أو خلد الماء بمزيج من الصفات المتداخلة التي حيرت التطوريين !!!..
    ويخلق الخفاش : وهو حيوان يطير !!!!.. وهكذا ...
    وقد اضطر الحوت التطوريين لتأليف خرافة جديدة عن :
    نزول الحيوانات الثديية من جديد في شجرة التطور إلى الماء ؟!!..
    بمعنى :

    لم يكتفوا بفشلهم في تفسير خروج الأسماك إلى البر وتحولها لزواحف او برمائيات أو ثدييات :
    ولكن اضطرهم الحوت إلى القول بالخرافة في الاتجاه المعاكس أيضا !!!..
    وكأن تحول الحيوانات من بعضها لبعض : هو نزهة ...!
    وأما آلية هذا التحول الخرافي لحيوان ثديي من البر إلى البحر كالحوت :
    فبالطبع لا يوجد أية آليات منطقية ككل خرافات التطور إلا الخيال المضحك !!..

    وهذا بالضبط ما أشار إليه داروين في مقدمة الطبعة الأولى من كتابه أصل الأنواع بغير استحياء كعادته :
    إلى أن نصحه أحد أصدقائه بحذفها في الطبعات التالية :
    لأنه يكفيه ما في كتابه من خرافات مضحكة كثيرة بالفعل !!..
    يقول داروين :

    I can see no difficulty in a race of bears being rendered, by natural selection, more and more aquatic in their habits, with larger and larger mouths, till a creature was produced as monstrous as a whale.
    CHARLS DARWIN , HARVORD UNI.PRESS;THE ORIGIN OF SPEICIER: A FACSIMILE OF THE FIRST EDITION 1964 ص. 184

    وأما معناها لمَن لا يعرف الإنجليزية فهي قوله - وبكل خبل المجانين - :

    " أنه لا يجد أي صعوبة في أن تتحول سلالة من الدببة بواسطة الانتخاب الطبيعي : وعن طريق المزيد من عاداتها المائية : وبالمزيد من اتساع أفواهها أكبر وأكبر : إلى أن تنتج لنا مخلوقا ًضخما ًمثل الحوت " !!!!..

    ما شاء الله على الخيال !!!!..
    الدب : يصير بقدرة قادر حوتا ًيصل وزنه لـ 30 طن !!!!!!..

    وللاطلاع على أكاذيب تطور الحيتان من كائنات برية :
    أرجو الاطلاع أخي على الرابط التالي من مدونتي لإحدى مشاركاتي هنا التي ربما فاتتك :
    http://abohobelah.blogspot.com/2012/06/6_9100.html

    وهنا كمالة قصيرة :
    http://abohobelah.blogspot.com/2012/...g-post_21.html

    وللمزيد : فإليك بالموضوع كله مقسم ومنسق لتيسير البحث فيه وتتبعه هنا :
    http://abohobelah.blogspot.com/searc...B7%D9%88%D8%B1

    حيث ترى فيه فضح عشرات أكاذيب التطوريين التي لولاها :
    لما خدعوا العالم لعشرات السنين بخرافات التطور المزعومة مثل كذبهم عن خرافة تطور الجنين البشري :
    http://abohobelah.blogspot.com/2012/06/blog-post.html

    وخرافة تطور الإنسان من سلف مشترك يشبه القرود
    :
    http://abohobelah.blogspot.com/2012/06/1.html

    وأكاذيب مخزية كثيرة للتدليل على ذلك السلف الموهوم وحلقاته الوسطى
    :
    http://abohobelah.blogspot.com/2012/...g-post_20.html

    وأكاذيب أخرى حول تطور الطيور من الديناصورات
    :
    http://abohobelah.blogspot.com/2012/06/6_9827.html

    وأخيرا ًوليس آخرا ً- لأن الموضوع ستجد فيه عشرات الأكاذيب لو قرأته من البداية - :
    فإليك نظرة قريبة عن الأسباب التي تدعو التطوريين للكذب (( دوما ً)) لنصرة خرافاتهم وفرضياتهم الساذجة :
    http://abohobelah.blogspot.com/2012/06/4.html

    والسؤال
    : هل تثق بعد ذلك فيما يقوله هؤلاء المستخفون بالعقل ؟!!!..
    والله لو قرأت تفسيرهم لظهور اللبن كعلامة مميزة في الثدييات لضحكت حتى تشبع !!!..
    ويمكنك أن تبحث عنها في مدونتي هناك : أو في هذا الموضوع هنا ...

    بالإضافة لاعتمادها على تحليل الشفرة الوراثية للكائن الحي الإحفوري والكائن الحي المعاصر،

    هل يمكنك أن تعطينا تفاصيل أكثر في هذا الصدد ؟!!!..
    لأن المعروف إلى اليوم هو تمايز كل كائن حي عن الآخر :
    حتى القريب منه في نفس الحوض الجيني كما يقولون .. مثل أنواع الكلاب المختلفة أو الماموث والفيل إلخ ..
    والكثير مما كان يظن التطوريين تطوره من بعضه البعض لقرب الشبه بينهما :
    مع الكشف الجيني عليهما تبين بعدهما كل البعد عن بعضهما البعض !!!..
    لذا أرجو تدعيم كلامك بتفاصيل حتى نستطيع التناقش حولها ...

    بالإضافة لاعتمادها على التحليل الطيفي للكربون وطبقات الأرض، بالإضافة إلى علم التشريح ووظائف الأعضاء.

    لا أعلم ما دخل التحليل الطيفي للكربون وطبقات الأرض فيما نحن بصدده الآن فأرجو التوضيح إذا سمحت ..
    وأما بالنسبة لعلم التشريح ووظائف الأعضاء :
    فهذه أيضا ًثبت أن للتطوريين باع طويل في الكذب فيها والاستخفاف بعقول الناس والحقائق العلمية !!!..
    ويمكنك الرجوع في ذلك كأمثلة للتالي :

    خداع التطوريين في نسبة تقارب التشريح ووظائف الأعضاء بين الإنسان وسلفه الشبيه بالقرود :
    http://abohobelah.blogspot.com/2012/06/1.html

    وأيضا ًخداعهم المتواصل في مسألة تطور الحيتان وأقدامها الضامرة :
    http://abohobelah.blogspot.com/2012/06/6_9100.html

    وأرجو الاهتمام بالفيديو الذي يثبت غشهم حتى في متاحفهم في آخر الرابط السابق : ومعه التالي :
    http://abohobelah.blogspot.com/2012/...g-post_21.html

    وأيضا ًيمكنك أخذ جولة في خداعهم عن التشريح ووظائف الأعضاء في :

    حلمات الرجال وذكور الثدييات
    :
    http://abohobelah.blogspot.com/2012/06/6_4900.html

    سمكة الكهوف العمياء
    :
    http://abohobelah.blogspot.com/2012/06/2_3272.html

    أجنحة الطيور التي لا تطير
    :
    http://abohobelah.blogspot.com/2012/06/3_461.html

    وهذا رابط أحبه عن تشريح الجمل وكيف أنه لا يمكن أن يتأتى لا بالصدفة المزعومة ولا بالانتخاب :
    http://abohobelah.blogspot.com/2012/06/6_9264.html

    2. من وجهة نظر تطورية ليس سبب طول عنق الزرافة هو أنها تمد عنقها إلى الأشجار ولكن يتم ذلك بإنجاب عشرات الزرافات ذات الصفات الوراثية المختلفة والتي تكون إحداها أطول في العنق (دون تدخل الزرافة الأم باسنطالة عنقها لتأكل)، فتستحق الزرافة ذات العنق الطويل البقاء بسبب قدرتها على تناول غذاء لم تستطع بقية الزرافات الوصول إليه، المسألة في رمتها من منظور تطوري هي اختلاف وراثي ناتج عن التمايز الجيني، وليس اكتساب.
    والأمر ينطبق كذلك على قوة النجار والحداد وأفراد القبيلة التي ذكرتها في مثالك.
    أما فيما يتعلق بالزواحف فهي كونت أطرافها من وجهة النظر التطورية قبل خروجها من الماء.
    دعنا من خرافة تكوين الزواحف لأطرافها في الماء أولا ًقبل الخروج للبر :
    فالأمر ليس بالسطحية ولا البساطة التي تظن أخي الكريم ...
    فالخروج للبر يلزمه مجموعة من التغيرات الكاملة التعقيد والترابط : وعلى شرط :
    أن تتم كلها معا ًفي آن واحد قبل الخروج للبر لاستمرار الحياة الطبيعية خارج الماء !!!..

    فيجب
    تغير الهيكل العظمي والعضلي لتتحول الزعانف إلى أقدام ...!
    ومعهما الجهاز العصبي والتغذية لهما ...!
    ومعهم التغير في نظام التنفس ..!
    ومعهم التغير في نظام الإخراج / التبول لموازنة الماء ..!
    ومعهم التغير في نظام العرق لاختلاف درجة الحرارة عن تحت الماء وأسلوب الحياة ..!

    فهل تعتقد أنه ( من الصدفة والطفرات ) أن يحدث كل ذلك في سمكة ؟!!!!!!..
    يمكنك النظر هنا لمزيد من التفصيل :
    http://abohobelah.blogspot.com/2012/06/5.html

    وعلى هذا
    : دعنا نتحدث عن مسألة تطور الزرافة تحديدا ً:
    والافتراضات الخيالية التي يتم وضعها من قبل التطوريين لتمرير الفكرة على الناس والعوام ...
    أنت تقول أخي - وبعد أن ذكرت تنوع الصفات في الزراف بين قصير العنق وطويله - :

    وفيما يتعلق بموضوع الحاجة إلى الأشجار الطويلة، فلم تكن الطبيعة دائماً غنية بالموارد ففي فترات حدثت مجاعات واصطدمت الأرض بمذنبات قضت على مجموعة كبيرة من التنوع الغذائي، وإذا أضفنا إلى ذلك أن الزرافة ليست في أعلى المسلسل الغذائي سنجد أنها ستمثل غذاء هي نفسهل إن لم تتوافق مع أنواع كثيرة من الغذاء.

    لم أفهم معناه ....
    وسنعود إلى الزراف مرة أخرى بعد الرد على خروجك الثاني لموضوع آخ وهو التهجين هذه المرة حيث قلت :

    3. ذكرت في حديثك - أخي - أنه رغم مرور آلاف السنين لم تر كائناً يتطور، وأقول لك أن التأريخ الحديث بدأ منذ خمسة آلاف عام فقط وهذه الفترة غير كافية من وجهة نظر تطورية لانفصال نوع جديد. ضف إلى ذلك أن الفصل الأول من كتاب أصل الأنواع كان يتحدث عن الحيوانات الداجنة التي تطورت من كائنات برية بما أسماه داروين بالانتخاب الصناعي، حتى وظفها الإنسان لخدمته، وحتى الآن يستخدم مربو الحمام والخيول والكلاب الانتخاب الصناعي بالتهجين لاستولاد أنواع جديدة.

    أقول :
    التهجين يسمى عند التطوريين بـ ( التطور الأصغر ) أو (microevolution)
    وذلك في إشارة منهم إلى أنه يقود (علميا ًمن وجهة نظرهم) إلى التطور الأكبر أو التام وهو :
    (macroevolution) !!!!..
    أقول :
    وهذه خرافة أخرى ...
    لان التهجين له أيضا ًحدوده : لم ولن يتخطاها طوال تاريخ الحياة على الأرض !!!!..
    فدوما ًله حائط سد لا يتخطاه وهو : أنه لا يمكن ظهور كائن جديد منه أبدا ًخارج نطاق الوالدين !!!..
    كما أن الناتج دوما ًيكون عقيما ً(كالبغل مثلا ًفي حالة الحصان والحمار) !!!..

    وحتى لو تم تلقيح هذا الهجين وراثيا ً(وهذا لا يتم في الطبيعة وإنما هو من صنع الإنسان الحديث بالبيولوجيا الجزيئية) :
    فلا يخرج الناتج من جديد عن صفات الآباء !!!!!!..
    إذا ً: ربط التهجين بالتطور :
    هو أكذوبة ادعاها داروين وأفرد لها فصولا ًفي كتابه محاولا ًتمثيل دلالتها تلك !!..
    والمصيبة المضحكة أنه هو نفسه يعترف أنه استوحى فكرة الانتخاب الطبيعي :
    من التهجين الذي يقوم به البشر لانتقاء وتحسين الصفات !!!..
    فقاس بذلك الغير عاقل (وهو الانتخاب) بعاقل : وهو البشر !!.. حيث يقول :

    For brevity sake I sometimes speak of natural selection as an intelligent power in the same way as astronomers speak of the attraction of gravity as ruling the movements of the planets, or as agriculturists speak of man making domestic races by his power of selection
    (P 6-7 : the Origin of Species )

    The key is man's power of accumulative selection: nature gives successive variations; man adds them up in certain directions useful to him
    ( Ch1 : the Origin of Species)

    If feeble man can do much by his powers of artificial selection, I can see no limit to the amount of change, to the beauty and infinite complexity of the coadaptations between all organic beings, one with another and with their physical conditions of life, which may be effected in the long course of time by nature's power of selection
    (Ch4: the Origin of Species )

    وهذا الخلل الصريح والواضح الذي بنى عليه داروين قياس الانتخاب الطبيعي :
    بالانتخاب البشري - أو الصناعي كما يسمونه - :
    قد تنبه إليه ستيفن جولد Stephen Gould وذكره في كتابه Ever Since Darwin ص 41
    حيث قال :

    The principle of natural selection depends upon the validity of an analogy with artificial selection

    وشكرا ًللأستاذ عبد الله الشهري من منتدى التوحيد لأنه أول مَن أبرز تلك اللفتة المهمة لي ...
    ولمزيد من المعلومات الهامة عن التهجين وعرقلته هو الآخر لخرافة التطور :
    http://abohobelah.blogspot.com/2012/06/6_4690.html

    رغم ذلك هناك بعض الكائنات الدقيقة ذات دورات الحياة القصيرة والتمايز العالي مثل فيروس الإيدز حيث كان ينتج فيرزوسات ذات خصائص جديدة غير مستجيبة للأمصال التي تحقن في المريض. وهذا هو سبب عدم القدرة على إيجاد علاج لهذا المرض القاتل.

    لا أعرف أيضا ًما دخل ذلك بموضوعنا الآن .. فحبذا التوضيح إذا سمحت ...
    ونعود أخيرا ًلخرافة تطور الزرافة حيث قلت أخي :

    4. أما سؤالك عن القضاء على الأشجار القصيرة، فلم يقض عليها الجدب بل قضى عليها أنها غذاء رئيس لمعظم الاكائنات التي قضت عليه ثم ظهرت الحاجة للتحور إلى أنواع جديدة.

    أقول : إذا كان هذا هو السبب حقا ً:

    1- فلماذا الزراف فقط هو الذي تم انتخاب الطويل الرقبة منه :
    وليس الغزال مثلا ًأو غيره من الحيوانات التي تتغذى مثله من الأشجار القصيرة ؟!!!..

    2- لماذا لم يموتوا جميعا ً؟؟؟..

    3- لماذا لم يرحلوا : وخصوصا وأن هذا التطور المزعوم من المفترض أنه أخذ ملايين السنين !!!..
    وإلا :
    هل تصور مثلا ًزيادة 1 سم أو 2 سم في عنق زرافة قصير : سيصنع فارقا ًفي الطعام (هذا من جهة) ؟
    أو حتى سيصنع فارقا ًفي جيل كامل :
    سيتم توريث هذه الصفة له مستقبلا ًقبل أن يموت كغيره ممَن هلك لقصر رقبته ؟!!!..

    4- لماذا لا نرى أمثال تلك الطفرات اليوم ؟!!!..
    وإن دل ذلك على طول الفترة الزمنية بين كل زيادة وأختها وكما هو مفهوم كلامك في عدم رؤيتنا للتطور اليوم :
    فذلك يؤكد كلامي أعلاه أكثر وأكثر وهو :
    موت الزراف الطويل العنق قليلا مثله مثل غيره لأنه لن يصنع معه سنتيمترات فارقا ًكبيرا ً:
    للبقاء حيا في الجدب لآلاف السنين !!!!!..
    ولو أجبت بأنه استطاع البقاء :
    لأجبتك بأن ذو الرقبة القصيرة أيضا ًيستطيع البقاء كل تلك الفترة قياسا ًعليه !!!..

    ومما سبق :
    السيناريو كله علميا ًومنطقيا ًمرفوض !!..
    والواقع يجري بغيره وهو رحيل الحيوانات من مناطق الجدب بحثا ًعن مناطق الزرع الذي يناسبها !!!..

    5. فيما يخص قصر أرجل الزرافة للشراب، فإذا أدت طريقة شربها إلى موتها فبالضرورة ستبقى الزرافات التي تغير طريقة شرابها أو سينقرض نوع الزراف، والمسألة مسألة وقت.

    ربما أنت لم تلاحظ أن حفريات الكائنات الحية من ملايين السنين :
    هي نفسها بنفس شكلها وتكوينها اليوم لم تتغير !!!..
    وأرجو الاطلاع على الرابط التالي للفائدة :
    http://abohobelah.blogspot.com/2012/06/6.html

    ولو أحببت أن ترى صورا ًودلائل
    :
    فإليك هذه الروابط بالصور على ثبات شكل وتكوين الكائنات الحية منذ مئات ملايين السنين وملايين السنين وإلى اليوم :
    http://abohobelah.blogspot.com/2012/06/8.html

    http://abohobelah.blogspot.com/2012/06/9.html

    في الختام أقدم لك خالص شكري وتقديري لاهتمامك بالرد على المشاركة السابقة التي كانت مفيدة ملقتت انتباهي كثيراً لنقاط مهمة.
    لك مني الود والتقدير والاحترام


    وأنت كذلك أخي ...
    ونصيحتي لك :
    مَن تعرفه وقد اشتهر بالكذب : فلا تصدقه ....
    وكل عام وأنت بخير ...

    التعديل الأخير تم 07-31-2012 الساعة 03:53 PM

  4. #124

    افتراضي


    هذه إضافة جديدة من حواري مع الأخ عادل صاحب المشاركتين السابقتين :
    رأيت أن أضيفها هنا للفائدة وتعلقها بـ : هل كان يعتقد داروين بتوريث الصفات المكتسبة ؟!..
    ----------

    أنا متأسف على تأخر الرد، ولكنك أخي كلفتني بواجب منزلي ضخم لأمر على كل هذه الروابط التي نصحتني بها، ورغم محاولتي أن أقنعك بأن تضع لي هنا روابط المواضيع التي تعتقد أنها تخدم موضوع النقاش ولكن يبدو أنك كنت تحب لي الفائدة لكي أمر على كل هذا الكم الضخم من المواضيع.
    ولكن ، وبعد أن أكملت جميع المواضيع، لم أجد ولا رابط واحد، يحمل دليل على أن نظرية التطور تقول أن الصفات الوراثية المكتسبة يمكن توريثها، وهو الموضوع الأساسي الذي بدأ منه هذا الحوار الشيق، وقد ذكرت لك ترتيب الأحداث التي تتم بها ميكانيكية التطور مع أخذ مثال عنق الزرافة كمثال.
    وأنا كنت اتوقع أحد ردود مححدة:
    (1) أن تقول لي أنك اقتنعت أن النظرية لم تذكر أن الصفات المكتسبة تورث.
    (2) أن توضح لي في أي صفحة من كتاب أصل الأنواع ذكر الكاتب أن الصفات المكتسبة تورث.
    (3) أن تذكر لي مشكلة في طريقة توريث الصفات المكتسبة بالطريقة التي وصفها داروين في كتاب أصل الأنواع.
    جدير بالذكر أنني - وإلى هذه النقطة - لم أناقش مدى صحة أو خطأ نظرية التطور، من حيث كونها نظرية، كل الذي أحاول أن أقوله هو أن أرد على موضوعك لتوضيح اللبس الذي اعتقد أنك وقعت فيه.

    أهلا ًبك من جديد أخي عادل ....
    ولا ..
    لا يبدو أنك قرأت كل ما كتبته أنا للأسف ..!!
    أو أنك قرأت : وأنت على توجيه مسبق لعدم الإلتفات لأي شيء يختلف معك ...!

    حسنا ًأخي الكريم ...
    تجد من الرابط التالي من مدونتي بعنوان :
    5)) كيف انتقلت الأسماك إلى البر :
    http://abohobelah.blogspot.com/2012/06/5.html

    تجد قرب نهاية الموضوع : التفسير الساذج التالي :
    وهو عندما يفقد التطوريين عقولهم أمام عوائق تفسير التطور تفسيرا ًمنطقيا ً:
    فيلجأون لنظرية تحور الأعضاء نتيجة لما حولها : ثم توريث ذلك للأبناء !!!!!..
    وإليك اقتباس كلامي - ويمكنك مراجعته من نفس الموضوع هنا في المنتدى - :

    ولكن يبقى السؤال :

    ما هي عوائق تفسير التطوريين لانتقال الكائنات الحية من البحر إلى البر ؟!!!..
    أقول :

    >>>>
    منهم مَن يفسر ذلك بالتحور للأعضاء !!.. ثم انتقال ذلك التحور (وراثيا ً) عبر الجينات !!..
    وهذه فيها من المغالطة والسفاهة المنطقية والعلمية : ما لنظرية لامارك عن عنق الزرافة وطوله لو تتذكرون !
    إذ :
    الصفات المكتسبة من البيئة الخارجية والتأثر بها : لا تنتقل عبر الوراثة والجينات !!!..

    وأمثلة القائلين بتلك السذاجات من (أنصار التطور) هو : ديمرسوي Ali Demirsoy..
    http://tr.wikipedia.org/wiki/Ali_Demirsoy
    وهو واحد من أشهر أعلام نظرية التطور في تركيا يقول :
    " ربما تكون ذيول الأسماك التي تحتوي على رئة : قد تحولت إلى أرجل للبرمائيات : عندما زحفت هذه الأسماك في ماء فيه وحل " !!!..

    والنص باللغة الإنجليزية هو :
    "Maybe the fins of lunged fish changed into amphibian feet as they crept through muddy water."

    ولا تعليق !!..

    وقد كررت الإشارة لهذه المعلومة في النقطة التالية لها أيضا ً:
    6)) الحوض الجيني : العقبة الكئود !!..
    http://abohobelah.blogspot.com/2012/06/6.html

    حيث قلت :

    حيث من بعد استبعاد فرضية ديمرسوي نصير التطور التركي عن تحول وتحور أعضاء السمكة بالاستخدام والبيئة الخارجية (نفس نظرية توريث الصفات المكتسبة الساذجة للامارك) :
    فلن يبقى أمام التطوريين والداروينيين كما قلنا إلا :
    الحل السحري : الطفرات !!!..

    وأقول لك أخي عادل :
    أنت الذي لم تنظر إلى الوسط (العلمي) الذي فيه أنشأ دارون فكرته لنفي الإله !
    فلم يكن قد ثبت بعد أن الصفات المكتسبة لا تورث كما نعرفها نحن الآن !!!..
    بل كان يُعتقد أن الصفات المكتسبة في حياة الكائن :
    تورث لنسله عن طريق الدم !!!!..

    وقد أشرت أيضا ًلهذه المعلومة في أول رابط من موضوعي في المدونة وهنا :
    1)) نظرة سريعة على كتاب أصل الأنواع لداروين :
    http://abohobelah.blogspot.com/2012/03/blog-post.html

    حيث قلت :

    2...
    فبالنسبة لمسألة انتقال الصفات من جيل لآخر : فكان الاعتقاد السائد من قبله هو أن الصفات الوراثية تنتقل من جيل لآخر عبر الدم !.. إلى آخر هذه الاعتقادات الغامضة والخاطئة ...!

    وهكذا لم يجد دارون أي مشكلة في ادعاء انتقال الصفات المكتسبة من جيل لآخر !
    < وما زال بعض أنصار التطور إلى اليوم : يفكرون هذا التفكير الساذج كما سنرى بعد > !

    كما أشرت أخي عادل أيضا ًإلى :
    تصريح داروين بهذه الفكرة البلهاء في مقدمة الطبعة الأولى من كتابه أصل الأنواع :
    والتي تم حذفها فيما بعد تحت رغبة أحد أصدقائه لفجاجتها ..!

    وأما الدليل أنك لا تقرأ كلامي بتمعن أو بقلب مُسبق الرأي لصالح التطور فلا تنتبه للمكتوب :
    فانظر أخي الكريم لأول رد لي عليك هنا .. وإليك رابطه من مدونتي أيضا ًتحت عنوان :
    52)) خرافة استطالة عنق الزرافة .. وأشياء أخرى :
    http://abohobelah.blogspot.com/2012/...g-post_31.html

    حيث قلت لك فيه بالحرف :

    فبالطبع لا يوجد أية آليات منطقية ككل خرافات التطور إلا الخيال المضحك !!..

    وهذا بالضبط ما أشار إليه داروين في مقدمة الطبعة الأولى من كتابه أصل الأنواع بغير استحياء كعادته :
    إلى أن نصحه أحد أصدقائه بحذفها في الطبعات التالية :
    لأنه يكفيه ما في كتابه من خرافات مضحكة كثيرة بالفعل !!..
    يقول داروين :

    I can see no difficulty in a race of bears being rendered, by natural selection, more and more aquatic in their habits, with larger and larger mouths, till a creature was produced as monstrous as a whale.
    CHARLS DARWIN , HARVORD UNI.PRESS;THE ORIGIN OF SPEICIER: A FACSIMILE OF THE FIRST EDITION 1964 ص. 184

    وأما معناها لمَن لا يعرف الإنجليزية فهي قوله - وبكل خبل المجانين - :

    " أنه لا يجد أي صعوبة في أن تتحول سلالة من الدببة بواسطة الانتخاب الطبيعي : وعن طريق المزيد من عاداتها المائية : وبالمزيد من اتساع أفواهها أكبر وأكبر : إلى أن تنتج لنا مخلوقا ًضخما ًمثل الحوت " !!!!..

    ما شاء الله على الخيال !!!!..
    الدب : يصير بقدرة قادر حوتا ًيصل وزنه لـ 30 طن !!!!!!..

    فهل استوقفك تعبير داروين بالعادات المائية واتساع أفواه الدببة أكثر فأكثر ؟!!!..
    أرجو أن يكون المعنى أوضح من أن أشرحه لك أخي بارك الله فيك ..

    ولذلك تجد علماء أوروبا أنفسهم وحول بدايات القرن الـ 20 المنصرم :
    قد سخروا من داروين لتأثره بتلك الفكرة التي أثبت العلم ضلالها وزيفها وخطأها !!!..

    >>>
    يذكر العالم (إنلي دوسيون) في كتابه (الله والعلم) في طبعة 1912 م :
    " إن الغرضين اللذينِ يقوم عليهما مذهب داروين هما : الانتخاب الطبيعي .. وانتقال الصفات المكتسبة .. وقد أثبت (هربرت سبنسر) هدم الفرض الأوّل من أساسه !!!.. ونقض (وايزمان) إمكانية انتقال الصفات [المكتسبة] بطريق الوراثة !!!.. وبرهن على أنّ هذه المشاهدات المزعومة : لا تقوم إلاّ على حكايات مخترعة !!.. ولا تعلو قيمتها العلمية عن قيمة حكايات المرضعات [والعجائز] " !!!!..

    >>>
    ويقول العالم (بلوجر) الألماني ردا ًعلى تعلق الداروينيين بانتقال الصفات المكتسبة :
    " لم أجد واحدة من هذه المشاهدات : تثبت انتقال الصفات [المكتسبة] بالوراثة " !!!..

    >>>
    ويقول العالم الفيزيولوجي (دوبوا ريموند) :
    " إذا أردنا أن نكون مخلصين : وجب علينا أن نعترف بأنّ وراثة الصفات المكتسبة : قد اختُلِقت لمجرّد تعليل الحوادث المراد تعليلها !!!.. وإنّها هي نفسها من المفتَرضات الغامضة " !!!..

    >>>
    ولذلك كان رأي (دائرة المعارف الكبرى الفرنسية) في نظرية داروين :
    " إن النظرية الداروينية لسوء الحظ : مختلة من أساسها !!.. لأنها تفرض أنّ جميع الصفات النافعة [المكتسبة] : قد حدثت بالمصادفة !!.. وبالتالي : جميع الحيوانات حدثت على ما هي عليه اتفاقاً (مصادفة) !!.. وهو فرض يلاشي المسألة نفسها " !!!..
    -------

    وأنصحك أخيرا ًأخي عادل : وكلما تذكرت مثال الزرافة - وطالما يبدو أنك لم تفهم كلامي فيه - :
    أن تتذكر معه سؤالين هامين وهما انتقال الأسماك إلى البر : وانتقال البريات إلى الجو !!..
    وحاول أن تطبق عليهما ما ترى صحته في تطور الزرافة لتعرف صحة ما تفكر فيه من عدمه ..

    وأرجو الاستعانة في ذلك بما كتبته ونقلته أنا عن المعضلتين في روابط موضوعي :
    حيث يبدو أن مسألة التطور عند المؤمنين به : تأخذ تفكيرا ًسطحيا ًجدا ًفعلا ً!!!..
    تفكيرٌ : يتخطون فيه كل العوائق العلمية والتشريحية والمنطقية !!!!..

    فبالنسبة لتطور الأسماك إلى البر : أنصحك بقراءة الرابطين التاليين من مدونتي :
    5)) كيف انتقلت الأسماك إلى البر :
    http://abohobelah.blogspot.com/2012/06/5.html

    6)) الحوض الجيني : العقبة الكئود :
    http://abohobelah.blogspot.com/2012/06/6.html

    وأما بالنسبة لمعضلة إعجاز خلق الطيور واستحالة تطورها بكل سيناريوهات التطور الخرافية :
    فسوف تجد في الرابط التالي الكثير عن خصائصها - وليس في الأجنحة فقط - :
    44)) شبهة أجنحة الطيور التي لا تطير :
    http://abohobelah.blogspot.com/2012/06/3_461.html

    وكل عام وأنت ومَن تحب بخير أخي الكريم ...

    التعديل الأخير تم 08-20-2012 الساعة 01:48 PM

  5. #125

    افتراضي


    أعتقد أن هذه هي الرسالة الأخيرة بإذن الله تعالى للرد على نقطة سؤال الأخ عادل أحمد ...
    حيث اضطرني في النهاية للإتيان له بالأدلة من كتاب داروين نفسه : أصل الأنواع :
    على أن داروين كان متأثرا ًبفكرة توريث الصفات المكتسبة ...
    وإليكم النقل الذي أحسبه هاما ًلكل مَن سأل أو يسأل في هذه النقطة تحديدا ً:
    -------------

    على الرغم من عدم إجابتك أخي الكريم عادل - وقد مضت قرابة 6 ساعات - عن سؤالي لك :

    هل قرأت كتاب أصل الأنواع : النسخة العربية التي أشرت أنت لها بالفعل ؟؟؟؟..
    وذلك رغم أني أرى معرفك منذ الصباح في الموضوع : ومنذ قرابة الساعتين أيضا ً:
    إلا أني سأبادر أنا بكتابة الرد ...
    والله المستعان ...

    أنت قلت أخي :

    لك التحية أخي العزيز وأتمنى أن يمر عليك كل عام ويجدك في أتم صحة وعافية.
    - أولاً: فيما يخص تعليقك عن أنني قرأت وأنا على توجيه مسبق لعدم الالتفات لأي شيء يختلف معي، فأنا أكف عن الرد عن هذه الملاحظة تهذيباً وتقديراً لشخصك أخي العزيز.
    - وأما فيما يتعلق باستدلالك بوجهة نظر العالم (لامارك) عن توارث الصفات المكتسبة فأنا سأعود بك إلى كتاب أصل الأنواع للكاتب تشارلز داروين في ترجمة مجدي محمود المليجي عن دار المجلس الأعلى للثقافة، الطبعة الأولى عام 2004، في فصل (نبذة تاريخية عن تطور المعتقدات حول نشأة الأنواع الحية قبل نشر الطبعة الأولى لهذا العمل)، وفي تعليق الكاتب على كتاب (الفلسفة الحيوانية) للكاتب (لامارك) الذي استددلت به على التوارث بناءً على انتقال الصفات المكتسبة، يقول الكاتب في صفحة (39):
    وفيما يتعلق بالوسائل التي تمت عن طريقها التعديلات، فإنه – أي لامارك – عزا بعضاً من منها إلى التأثير المباشر للعوامل الطبيعية للحياة، وبعضاً منها إلى التهجين بين الأشكال الموجودة فعلاً، والكثير منها إلى الاستخدام وعدم الاستخدام، وهذا ما يعني تأثيرات السلوك، ويبدو أنه يعزو إلى هذا العامل الأخير كل التكيفات الجميلة في الطبيعة، مثل العنق الطويل للزرافة.
    وبما أن الفصل يتحدث عن المعتقدات التي سبقت نشر مصنفه فمن غير الجائز المحاجة بدراسة سبقت النظرية لدحضها، كما يدل على اختلاف الكاتب مع لامارك فيما يتعلق بآلية التوريث.
    - في الباب الثاني من الكتاب، التمايز تحت تأثير الطبيعة، في القسم (الاختلافات الفردية) يقول الكاتب (أن الاختلافات الفردية البسيطة التي تظهر على الذراري التابعة لنفس الأبوين، هي التي تزود الانتخاب الطبيعي بالأدوات اللازمة للعمل عليها).
    وبذلك يحدد الكاتب الميكانيكية التي يقوم عليها التطور، وهو الفروق الفردية بين الأفراد الناتجين عن نفس الأصل، وليس الصفات المكتسبة عنهما.
    أما في الفصل الرابع (الانتقاء الطبيعي - البقاء للأصلح) يقول الكاتب في تلميح عن التمايز تحت تأثير التدجين في صفحة 160:
    (إن الإنسان لا يستطيع استحداث ضروب، ولا يستطيع أن يمنع ظهورها، ولكنه يحتفظ ويكدس كل ما يحدث على علاته.
    وجملة (يكدس ما يحدث على علاته) فيها إشارة قوية لأن العملية تلقائية ولا دخل للصفات المكتسبة بها.
    - ويقول الكاتب في صفحة 161:
    العديد من الكتاب قد أخطأوا الفهم أو اعترضوا على مصطلح الانتقاء الطبيعي، وبعضهم وصل إلى أنه تخيل أن الانتقاء الطبيعي يسبب التمايز، مع أنه لا يتضمن إلا الحفاظ فقط على مثل هذه التمايزات كما تظهر.
    وهذه إشارة من الكاتب لأن التميزات تتكدس كما تظهر، وليس كما ينقلها الآباء عن طريق توريث الصفات المكتسبة في فترة بقاء الأبوين.
    - في صفحة 352 يقول الكاتب:
    فإنه قد يكون من المستحسن أن نشرح مرة أخرى كيف سيقوم الانتقاء الطبيعي بدوره في جميع الحالات العادية، فالإنسان قد قام بتعديل البعض من حيواناته بدون الحاجة للاهتمام بتفاصيل خاصة في التركيب، وذلك ببساطة عن طريق الحفاظ والاستيلاد من أسرع الأفراد، كما في حالة حصان السباق وكلب الصيد السلوقي، أو كما فعل في حالة ديك المصارعة، وذلك بالإنسال من الطيور المنتصرة، وهذا هو الحال مع الزرافة في بداية نشوئها تحت ظروف الطبيعة، فإن الأفراد التي كانت ترعى على مستوى عالي، وكانت قادرة أثناء فترات القحط على أن تصل إلى مستوى أعلى ولو ببوصة واحدة أو بوصتين فوق الآخرين، فهي التي كانت غالباً سوف تبقى، وذلك لأنها سوف تكون قد جاست خلال بقاع القطر بحثاً عن الطعام.
    ويستمر الكاتب في نفس الصفحة:
    وحقيقة الأمر أن الأفراد التابعة لنفس النوع، غالباً ما تختلف في الأطوال النسبية لجميع أجزاء جسدها، وذلك من الممكن مشاهدته في العديد من أعمال التاريخ الطبيعي، والتي تقدم لنا قياسات دقيقة في هذا الموضوع، وتلك الاختلافات النسبية الناتجة عن قوانين النمو وتعدد الخصائص، ليس لها فائدة أو أهمية على الإطلاق لمعظم الأنواع. ولكن الأمر كان سيصبح مختلف مع الزراف الناشئ، عندما نضع في الاعتبار عاداته الحياتية المحتملة، فتلك الأفراد التي كان لها جزء واحد أو أجزاء متعددة من نجسدها أكثر استطالة فإنها في العادة كانت سوف تبقى على قيد الحياة. وهي التي كانت ستتزاوج وتتكر ذرية، إما وارثة لنفس الميزات الجسدية أو لديها القابلية لتعديل الخصائص مرة أخرى على نفس المنوال.
    وستمر الكاتب:
    وإنه لمن المشكوك فيه إذا ما كان قد طرأ على تفكير أحد أن يدرب كلباً على الإرشاد إذا لم يكن هناك كلب ما قد أبدى بطريقة طبيعية قابليته لهذا المسار.
    وفي هذا أيضاً إشارة من الكاتب لأن القابلية تكون طبيعية للتمايز، وليست ناتجة عن اكتساب من الأبوين.
    وعليه لا يمكن الأخذ بآراء العالم لامارك للمحاجة بها على نظرية التطور فيما يخص تمرير الصفات السلوكية المكتسبة للكائن
    - أما تعبيرك المقتبس من داروين (أنه لا يجد أي صعوبة في أن تتحول سلالة من الدببة بواسطة الانتخاب الطبيعي : وعن طريق المزيد من عاداتها المائية : وبالمزيد من اتساع أفواهها أكبر وأكبر : إلى أن تنتج لنا مخلوقا ًضخما ًمثل الحوت)
    فأنا للأسف لم أجد في الكتاب الصفة التي يرد فيها هذه النقطة، لذلك أرجو منك أن تساعدني بتحديد الصفحة التي ورد فيها هذا التعبير حتى أعرف ما الذي كان يقصده الكاتب من ذلك.
    وأقول لك في نقاط ...

    1...
    بالنسبة لما نقلته لك من رأي داروين في تطور سلالة من الدببة إلى حيتان : بفعل المزيد من العادات المائية !!!.. والمزيد من اتساع أفواهها أكبر وأكبر !!!.. فهذه كانت من صورة فاكس للطبعة الأولى لكتابه أصل الأنواع مأخوذة عام 1964 :
    CHARLS DARWIN , HARVORD UNI.PRESS;THE ORIGIN OF SPEICIER: A FACSIMILE OF THE FIRST EDITION 1964 ص. 184

    وقد ذكرت لك أنه تم حذفها من المقدمة !!!.. ولذلك - وبالطبع - :
    فلن تجدها في الكتاب : لا في نسخته الإنجليزية : ولا في العربية المترجمة !!!..
    ولكن : لا بأس :
    فما سأذكره لك الآن من كتابه نفسه :
    سيفي بالغرض إن شاء الله وزيادة : وكما سترى معي بعد لحظات ....
    ولكن قبل أن أترك هذه النقطة :
    فتلك الخزعبلات التي أشار إليها داروين في مقدمة كتابه : وتم حذفها من المقدمة ومن صفحة 184 أيضا ً:
    تجد الإشارة إليها في صفحة الويكيبديا - الحيتانيات التالية :
    http://ar.wikipedia.org/wiki/%D8%AD%...8A%D8%A7%D8%AA

    ولكنك لن تجدها في النسخة الإنجليزية لنفس صفحة الويكيبديا !!!.. بل : ولن تجد أي ذكر لداروين أصلا ًفي الصفحة - وحتى لا يهتز عرش خرافة التطور أكثر مما هو يتهاوى بالفعل في السنوات الأخيرة !!!- .. وإليك اقتباس للإشارة إلى ذلك الجزء المحذوف ...
    حيث تجد في صفحة الويكيبديا - وتحت عنوان : (نبذة عن تطور الحيتان) :

    في سنة 1859 كان لداروين توضيحات (بشكل نظري) كيف قد نشأت الحيتان (Cetacea) الحالية. حسب داروين فانّ الحيتان والدلافين اصلهم يرجع إلى ثديات اليابسة, تلك الثديات التي كانت تحصل على معظم غذائها في الوسط المائي لذلك تكيّفت تلك الثديات مع الوسط الجديد, وكان العالم لامارك Lamarck يعتقد عكس ذلك, إذ انه كان يعتقد بان ثدييات اليابسة أن اصلها يرجع إلى ثديات الماء.
    وضرب داروين مثالا على ذلك وهو الدبّ الاسود, كان زميل له رآه في قارة أمريكا الشمالية, ذلك الشخص رأى الدب الاسود يسبح في بركة ماء بشكل متواصل لساعات عديدة دون توقف من اجل اصطياد الحشرات. إذا استمر هذا الدبّ (أو اي من حيوان ثدي آخر) ولاجيال عديدة جدا يبحث معظم وقته عن الغذاء في الماء فانه سيتكيف ويتصرف مثل الحيوانات المائية وبشكل تدريجي. وتبدأ اجسامهم بالتكيّف (التغيّر) من اجل سباحة وغطس أفضل, وبعد مدة طويلة (ملايين السنين) وبشكل تدريجي ينشأ حيوان على شاكلة الحيتان أو كلاب البحر.
    وإليك النص المحذوف بأكمله من الصفحة 184 : وفيه تعليق داروين على ما رآه صديقه هيرني :

    In North America the black bear was seen by Hearne swimming for hours with widely open mouth, thus catching, like a whale, insects in the water. Even in so extreme a case as this, if the supply of insects were constant, and if better adapted competitors did not already exist in the country, I can see no difficulty in a race of bears being rendered, by natural selection, more and more aquatic in their structure and habits, with larger and larger mouths, till a creature was produced as monstrous as a whale.
    Charles Darwin, The Origin of Species (1859 and 1984 editions), p. 184.

    والنص كان موجودا ًفي أول طبعة 1859 وإلى طبعة عام 1984 ص 184 !!!..

    2...
    أنت تحتج عليّ أخي الكريم بأنه : طالما ذكر داروين في : نبذته التاريخية عن تطور المعتققدات حول نشأة الكائنات الحية : أنه ذكر فيها لامارك وما اعتقده من (( توريث الصفات المكتسبة )) : فأنت تحتج عليّ أن ذلك دليلا ًعلى أن داروين لم يكن موافقا ًعلى ذلك !!!..
    أقول :
    من أين جئت بهذه القاعدة أخي لكريم ؟!!!..
    معلوم أن الكثير من الباحثين وقبل الشروع في بحثه أو كتابه : يشير إلى مجهودات غيره الذين سبقوه في نفس المجال : سواء المخطئين منهم أو المصيبين !!!..
    وذلك ما فعله داروين بالضبط !!!!..
    وإلا :
    فهو كما ذكر لامارك : فقد ذكر معه الكثيرون - لو أنك قرأت هذا الجزء من الكتاب أصلا ً- .. وعلى رأسهم ألفريد راسل والاس A.R. Wallace : والذي سبق داروين بتلخيص فكرته عن التطور : وباعتراف داروين نفسه !!!.. ولكن لمع نجم وصيت داروين : وغطى كتابه في الأهمية على رسالة والاس عن التطور بالانتخاب ...! ربما لكثرة ما كتبه داروين وألفه نتيجة خبراته من رحلاته ...
    والسؤال :
    هل يعتبر ذكر داروين أيضا ًلوالاس : هل يعتبر ذلك أنه غير موافقا ًعلى ما ذهب إليه والاس ؟!!!..
    والحق أنك لو كنت قرأت كل هذا الجزء من كتاب داروين - وليس أوله فقط حينما ذكر لامارك - : لعرفت أنه هناك الكثيرين الذين أخذ عنهم داروين الكثير من معطيات نظريته وفرضياته : وباعترافه هو نفسه !!!!..
    ولكني .........
    سأترك كل ذلك وأسألك عن لامارك نفسه ...
    أنت قلت :

    وفي تعليق الكاتب على كتاب (الفلسفة الحيوانية) للكاتب (لامارك) الذي استددلت به على التوارث بناءً على انتقال الصفات المكتسبة، يقول الكاتب في صفحة (39):
    وفيما يتعلق بالوسائل التي تمت عن طريقها التعديلات، فإنه – أي لامارك – عزا بعضاً من منها إلى التأثير المباشر للعوامل الطبيعية للحياة، وبعضاً منها إلى التهجين بين الأشكال الموجودة فعلاً، والكثير منها إلى الاستخدام وعدم الاستخدام، وهذا ما يعني تأثيرات السلوك، ويبدو أنه يعزو إلى هذا العامل الأخير كل التكيفات الجميلة في الطبيعة، مثل العنق الطويل للزرافة.
    وبما أن الفصل يتحدث عن المعتقدات التي سبقت نشر مصنفه فمن غير الجائز المحاجة بدراسة سبقت النظرية لدحضها، كما يدل على اختلاف الكاتب مع لامارك فيما يتعلق بآلية التوريث.
    أقول :
    ولماذا تريد أنت التفريق بين المحاجة بتوريث الصفات المكتسبة : فتتركه !!
    ثم لا تترك قول لامارك بالتهجين ؟!!!!!.. ورغم موافقة داروين عليه أيضا ًوتخصيصه لجزء لا بأس به من كتابه له ولشرحه ؟!!!!..
    فلماذا هذه الانتقائية أخي الكريم في الأخذ والترك من لامارك :
    رغم أنك ترى أن ذكر داروين له في تلك النبذة عن (تاريخ) معتقدات التطور : لا يصلح للمحاججة به ؟!!..
    غريب ........ صح ؟؟..

    3...
    والآن إلى صلب الإجابة ....
    هل قرأت أخي الكريم : أول باب من كتاب داروين بنفسك ؟؟؟؟؟....
    هل قرأت ثاني فصل فيه ؟؟؟...
    سواء في نسخته الإنجليزية :



    أو حتى العربية :



    أقول لك أخي الكريم :
    في هذا الفصل من بدايات كتاب داروين نفسه :
    يقوم بالتعليق فيه على ما كان سائدا ًفي وقته من معتقد توريث الصفات المكتسبة !!!..

    < أي لم أكن أكذب عليك قط عندما أخبرتك بذلك !!!! والحمد لله رب العالمين >

    بل :
    ويتحدث فيه عن أشهر الآليات التي ذكرها لامارك في نظريته عن التطور واستطالة الأعضاء - مثل عنق الزرافة - ألا وهي آلية :
    الاستخدام وعدم الاستخدام - أو - الاستعمال والإهمال !!!!!..
    فماذا قال داروين أخي ؟؟؟..
    أترك لك ولكل قاريء التعليق على الكلام التالي .......



    هه ؟؟؟.. ما رأيك في هذا الكلام الصريح والواضح والمباشر منه ؟!!!..
    يقول في أول سطر :

    << السلوكيات التي تتغير : تحدث تأثيرا ًوراثيا ً>> !!!

    ما شاء الله !!!.. يعني داروين لم يكن ملاكا ًأخي عادل ولا معصوما ًمن هذه الغلطة الساذجة !!!!!!..
    والعبارات التي وضعتها لك في مستطيلات زرقاء :
    هي عبارات موافقته على هذه الخزعبلات في وقته : واطمأنانه لها !!!!!..
    وذلك في خضم المثالين الذين تحدث عنهما في هذه الصفحة وهما :
    اختلاف وزن عظام جناح البط .. واختلاف حجم أثداء البقر والماعز !!!!..

    ومن هنا أخي الكريم ... وقبل أن أستكمل معك باقي النقل من كتابه :
    فداروين كان متخبطا ًمثله مثل غيره في تفسير الإعجاز في ملائمة أعضاء الكائنات الحية لبيئاتها !!
    ومن ضمن فرع الشجرة الذي كان مستمسكا ًبه من الغرق في بحر ذلك التخبط :
    هو القول بالتحور في البيئة واكتساب صفات يتم توريثها للأبناء !!!!..
    نعم ... لم يكن ذلك عند داروين هو الآلية الوحيدة لظهور الصفات :
    ولكنه مثله في ذلك مثل غيره - مثل لامارك الذي أشرت أنت له - : كان يضع آليات أخرى :
    مثل التهجين مثلا ً- وهنا خلط ساذج آخر بين التطور الأصغر كما يسمونه وبين التطور الأكبر - !!!..
    وفي النهاية :
    كلها تخرصات وافتراضات من قوم عاشوا قبل عصر الانفتاح العلمي على حقائق الوراثة وإعجاز الخلية والـ DNA !

    فمثال الزرافة : لن يتأثر داروين بمن أين أتت الزرافة طويلة العنق :
    هل من الفروق الفردية العادية من الطول والقصر كأي كائن حي : أم من الاستعمال كما قال لامارك :
    وإنما الذي يهم داروين هو عمل الانتخاب الطبيعي في استخلاص ذلك النوع من الزراف الطويل القامة دونا ًعن غيره ليبقى !!!...

    ولأتابع معك ...
    حيث ترى معي في الصورة التالية بوضوح :
    عزوه لسبب تدلي أذن بعض الحيوانات الداجنة إلى : عدم الاستخدام !!!!!!!!!!!!!!!!..
    < نفس أقوال لا مارك !!!!!!!!!!!!!!!!!!!!! فقط لكي تصدقني أخي بارك الله فيك >
    وتصريحه الذي وضعته لك في المستطيل الأحمر بأن هذا التفسير هو : الاتجاه الراجح !!..
    وإليك الصورة :



    ومن قرب نهاية هذا الفصل :
    نجد أن هذه النظرة القاصرة منه : طالت أيضا ًالنباتات وليس الحيوانات فقط ...!
    حيث نجده في معرض حديثه عن موضوع (( الارتداد )) في عودة الصفات الوراثية للأصل :
    يتحدث عن تجربة من خياله وهي : وضع نبات الكرنب في تربة مجدبة :
    ثم يفترض (مؤكدا ً) على أن التغييرات التي ستحدث للكرنب ساعتها ونسله بعد ذلك :
    ستكون بتأثير التربة وتلك البيئة المجدبة ......!!!..
    وإليك الصورة :



    وأما الجملة التي أحطتها بسحابة زرقاء في آخر الصفحة :
    فهي واحدة من مئات المرات - بلا أدنى مبالغة - والتي يستخف بها داروين بسخافة افتراضاته :
    وعدم اهتمامه بعدم تحققها قبل ولا بعد : رغم أنه يبني عليها نظريته المتهافتة !!!..
    وأما لكي تفهم ما أعنيه أكثر أخي :
    فأرجو قراءة - أو حتى مطالعة - الرابط التالي من مدونتي بعنوان :
    2)) بين يدي داروين في كتابه :
    http://abohobelah.blogspot.com/2012/06/2.html

    وأختم معك أخي بهذه الصورة لآخر ما قاله في هذه الفصول الأولى من بابه الأول :
    حيث نرى تأكيدا ًوتصريحا ًبتعلق الصفات المكتسبة للفقد : وهذه المرة بـ (الارتداد) :



    4...
    ومما سبق أخي :
    فلا أجد الحاجة للتعليق على باقي كلامك بأكمله : والذي انتقيته أنت من كتاب داروين :
    وخلعت عليه شروحات من عندك أنت :
    لا تـُلزمه في شيء بقدر ما وضحت لك الآن من تصريحاته هو نفسه !!!!..
    وأما بالنسبة لموضوع الزرافة التي عنقها أطول ببوصة أو بوصتين :
    فأرجو مراجعة ردي عليك فيها - وخصوصا ًردي الثاني الذي خصصتك به وليس الأخ عبد الحق - ..
    أو إعادة قراءته كاملا ً- الردين معا ً- من هنا :
    http://abohobelah.blogspot.com/2012/...g-post_31.html

    مع العلم بأني يمكنني أن أستطرد في ذكر عوائق ولا معقوليات أخرى لم أذكرها في وجه هذا التفسير الخرافي لطول عنق الزرافة ..
    ولكني دوما ًأحب ادخار وقتي وبعض ردودي لمناسبات أخرى ...

    وفقني ووفقك الله ..
    وهداني وإياك إلى ما يحب ويرضى ...
    وعلمني وإياك ما جهلنا : ووفقنا للعمل بما علمتنا ...

    وملحوظة أخيرة :
    أقول :
    سبحان الله الذي يقلب سلاح المعاندين للإسلام : إلى سلاح للإسلام !!!!..
    فهذا الكتاب أصل الأنواع :
    ظل عفريتا ًوبعبعا ًورمزا ًلتخويف المتدينين منه ورميهم بالتخلف والرجعية إلخ :
    طالما لم يجد مَن يرد عليه ويفصصه !
    وذلك لعدم وجود نسخة مترجمة منه ومنتشرة انتشارا ًكافيا ًلنقدها !!!..

    ثم يوقف الله تعالى أعداء هذا الدين نفسه لترجمة الكتاب :
    فيتبين به سخافة كاتبه وعقله الذي سخره فقط - وكما يقول هو في نبذته التاريخية عن التطور - :
    لإثبات ابتعاد ( الإعجاز الإلهي ) عن عملية الخلق !!!!..
    وبهذا : يفتح باب الإلحاد على مصراعية بإيجاد ( بديل ) بزعمه للخالق عز وجل !!!..
    فاستبدل في عقيدته ومَن تبعه : الله تعالى الخالق الحكيم المدبر العليم الخبير :
    بطبيعة صماء عمياء !!!!..

    فقام بترجمة الكتاب لأول مرة :
    أحد الليبراليين المصريين - وهي عادتهم في تهافتهم على كل ما يطعن في الدين من كتب الغرب - :
    ألا وهو المدعو : إسماعيل مظهر ...

    ثم أعاد جابر عصفور العلماني الفج : نفخ الروح في الكتاب بترجمة عربية جديدة :
    تخدع ببهرجها مراهقي وشباب وعوام وبسطاء الشعوب العربية والإسلامية :
    وهي ترجمة علماني آخر - أو تغريبي حداثي إن صح التعبير - وهو : مجدي محمود المليجي ..
    وتقديم نصراني وهو المدعو : سمير حنا صادق ...

    وكل ٌمنهم له فحيحه المسموم المكتوم للمز وغمز الدين باعتبار نظرية التطور هذه :
    مقيضة له - مثلما فعلت نظرية جاليليو بالكنيسة الأوروبية في زعمهم - ..
    وهنا أود الإشارة فقط لما جاء في هامش الصفحة الرابعة من الكتاب والتي كتبوا فيها :



    فالجملة الأخيرة التي خططت تحتها بالخط الأحمر – والتي يظنون أنها تعفيهم من المسؤلية - :
    هي أشبه بما نقوله بالعامية المصرية : " يقتل القتيل : ويمشي في جنازته " !!..
    حيث ماذا تغني هذه الجملة :
    مقارنة ًبنفث السم (الواضح) في الهوامش والتقديم والمقدمة :
    ومن كل مَن امتلأ قلبه وعقله جهلا ًوحقدا ًوغيظا ًمن الدين ؟؟!!..
    حيث اهتموا بذكر نبذة مما كتبه إسماعيل مظهر المترجم الأول للكتاب من قبل :
    ولم يذكروا للقاريء أنه ليبراليذكروني بالملحد بسام البغدادي مترجم وهم الإله لداوكينز - !!!..
    وأما الذي نضح بما في داخل قلوبهم من حقد وغل على الدين وثوابته
    < والتي هي في نظرهم رجعية وتخلف وجمود > :
    فهو ما نقرأه في تعليق المترجم مجدي محمود المليجي على نبذة إسماعيل مظهر :


    فيا ليت قومي يتعظون !!!!..

    التعديل الأخير تم 02-26-2013 الساعة 05:41 PM

  6. افتراضي

    جزاكم الله خير الجزاء

    وأسأل الله أن يعتنق الأسلام بعض الملحديين بسبب مشاركاتكم

    جزاكم الله ألف خير

  7. #127

    افتراضي

    متفرقات ..
    نبذة عن نشأة فكرة التطور قديما ًوحديثا ً..

    ما زلت إخواني أسعى إلى جمع كل المشاركات التي أراها مهمة - حتى ولو عرقلت الترتيب المفترض للمواضيع - وذلك لفضح أكذوبة التطور وتعريتها هنا :
    وأنقل لكم الآن ردي على سؤال للأخ الحبيب بحب ديني للتعريف بالتطور من وجهة نظر داروين والتطوريين حيث قال :

    أكتب نبذة عن ماهية التطور كما وصفه وعبر عنه دارون والتطوريين ؟
    فكانت الإجابة : والتي نقلتها أيضا ًفي رابط تنسيق مواضيع التطور في مدونتي هنا :
    http://abohobelah.blogspot.com/2012/...g-post_28.html
    ---------------

    بسم الله الرحمن الرحيم ...
    وكعادتي أخي الحبيب : سأضع ردي في نقاط لسهولة القراءة والتتبع ..

    1...
    في الماضي لاحظ الإنسان بفطرته العادية : تدرج ترتب المخلوقات على بعضها البعض .. بمعنى : أن الإنسان على رأس السلاسل الغذائية : يتغذى مثلا ًعلى الحيوانات (برية بحرية والطيور) وعلى النبات .. يليه الحيوان بتدرجاته .. يليه النبات .. وهكذا .. حتى يقبع في النهاية الجماد الأصم ... واشتهرت تلك السلسلة وذلك الترتيب باسم :
    (( السلسلة العظمى للموجودات ))

    2...
    أشار الكثير من الفلاسفة والعلماء لهذا التدرج والترتيب قديما ًمنذ اليونان (أفلاطون) .. ومرورا ًحتى ببعض الفلاسفة والعلماء المسلمين ..
    وهو أشبه بعمليات تقسيم الكائنات الحية لسهولة دراستها في العصر الحديث :
    نباتات كذا وكذا .. فقاريات .. لا فقاريات .. إلخ

    3...
    نلاحظ فيما سبق : أنه لا أحد قال بـ (تطور) أحد هذه السلسلة إلى الذي يليه وإنما فقط : (ترتيب) !!!..

    4...
    عند ترجمة كتاب أصل الأنواع لداروين : للغة العربية أول مرة على يد إسماعيل مظهر الملحد :
    فقد كتب هذا الأخير نبذة في مقدمة كتابه : حاول أن يثبت فيها قدم فكرة التطور والنشوء والارتقاء في التاريخ الإنساني عموما ً!!!..
    وذلك ليوحي بأنها فكرة (فطرية) ليست غريبة على العقل الإنساني أبدا ًتخيلها !!!!..
    < هكذا هي الأفكار الشاذة : لا تصدر إلا عن شواذ العقيدة التائهين في بحر الحياة >

    فبدأ بالإشارة إلى أقوال الفيلسوف الإغريقي أنتكسمندر (والصواب : أنكسيمندر Anaximander عاش 610 : 540 قبل الميلاد) ..
    والله أعلم بأمانة النقل لإسماعيل مظهر : ولكنه أوحى للقاريء بأن (تقسيم مراتب الكائنات) : يوحي بـ (تطورها من بعضها البعض) !!!!..
    وحاول نسبة ذلك أيضا ًبالتلميح تارة وبالتصريح تارة : لبعض مشاهير الإسلام أنفسهم على اختلاف مشاربهم مثل إخوان الصفا وابن مسكويه الخازن وابن خلدون والجاحظ إلخ ...

    5...
    ومن أبرع مَن تصدى لهذه الخزعبلات بالتفنيد وجزاه الله خيرا ًعنا - فقد أغنانا عن كثير بحث وتنقيب وترجمة - : هو أخ في الله : أفتخر أني أكتب في نفس الصرح الذي كتب ويكتب فيه هنا في منتدى التوحيد - وأدعو الله تعالى ألا يحرمنا من مجهوداته - ألا وهو الدكتور : حسام الدين حامد وفقه الله وحفظه من كل سوء ..

    6...
    فأما بالنسبة لتفنيد الدكتور حسام لمزاعم نسبة القول بالتطور لإخوان الصفا وأرسطو وابن رشد الحفيد إلخ وذلك في موضوعه : (( خرافة نسبة نظرية التطور لأهل القبلة : من قبل داروين )) :
    http://www.eltwhed.com/vb/showthread...CF%C7%D1%E6%E4

    والذي كتبه ردا ًعلى مزاعم الشيخ عبد الصبور شاهين المتأثر بكل هذه الأكاذيب :
    فقد لخصته لكم منسقا ًومرتبا ًفي موضوع (ما يجب أن تعرفه عن نظرية التطور) : وتجدونه في الرابط التالي من مدونتي تحت اسم :
    أكذوبة ما أسموه بنظرية التطور المحمدية :
    http://abohobelah.blogspot.com/2012/...g-post_06.html

    7...
    وعلى ذلك تتبقى أكذوبة واحدة لإسماعيل مظهر في نبذته عن قدم فكرة التطور التي ادعاها في مقدمة ترجمته لكتاب داروين أصل الأنواع : وتلك الأكذوبة هي : ما نقله ونسبه إلى الفيلسوف الإغريقي القديم أنتكسمندر (والصواب كما قلنا هو : أنكسيمندر Anaximander) والذي عاش 610 : 540 قبل الميلاد !!!..
    وسأورد لكم كلامه الذي نقله أولا ً: ثم الكلام الحقيقي ثانيا ً:
    لنعرف أن عدم الأمانة أو أخطاء النقل : هي صفة لصيقة للباطل لكي يستطيع فقط الوقوف ولو لقليل أمام الحق فيخدع العوام والبسطاء والجهال لبعض الوقت !!!..
    فقد نقل وكتب هذا الملحد :
    " وأقدم ما وصل إلينا مما عُثر عليه إلى الآن من تراث الأقدمين، هو ما قاله الفيلسوف الإغريقي "أنتكسمندر" (610 ق. م) "أن نشأة الكائنات الحية هو نتيجة تأثير الشمس على الأرض، وتميز العناصر المتجانسة بالحركة الدائمة، وأنّ الأرض كانت في البداية طينيةً ورطبةً أكثر مما هي عليه الآن، فلما وقع فعل الشمس دارت العناصر الرطبة في جوفها، وخرجت منها على شكل فقاقيع، وتولدت الحيوانات الأولى، غير أنّها كانت كثيفةً ذات صورٍ قبيحةٍ غير منتظمة، وكانت مغطاةً بقشرةٍ كثيفةٍ تمنعها من الحركة والتناسل وحفظ الذات، فكان لابد من نشوء مخلوقاتٍ جديدة، أو بسبب ازدياد فعل الشمس في الأرض لتوليد حيواناتٍ منتظمة يمكنها أن تحفظ نفسها وتزيد نوعها، أما الإنسان فإنّه ظهر بعد الحيوانات كلها، ولم يخل من التقلبات التي طرأت عليه، فخُلقَ أول الأمر شنيع الصورة ناقص التركيب، وأخذ يتقلب إلى أن حصل على صورته الحالية" (5)، وهذه الفقرة تحمل معظم مبادئ أصل الحياة والنشوء والارتقاء، والانتقاء والتمايز وتأثير الظروف المحيطة، وإذا كانت قد كُتبت من ستة قرونٍ قبل الميلاد، فلابد من وجود تلالٍ من المحررات المماثلة السابقة لهذه الحضارة المتوسطة الموضع في سجل الحضارات " !!!..

    وعزى إسماعيل مظهر هذا النقل إلى : (( دائرة المعارف العربية للبستاني )) !
    ويمكن الاطلاع على كلامه ذلك في الصفحة 52 من الترجمة العربية الثانية لكتاب أصل الأنواع لمجدي محمود المليجي ..

    < ملحوظة : البستاني هذا صاحب دائرة المعارف تلك : هو نصراني واسمه : بطرس بن بولس بن عبد الله البستاني .. وكتبها أيام حكم الخديوي إسماعيل على مصر >

    8...
    وبالطبع الكلام المنقول خطأ أعلاه : مربك لكل باحث عن الحق يعلم بجلاء أن خرافة التطور البلهاء : لم تظهر إلا متأخرا ًعند مَن كرهوا الخالق عز وجل في صورة الكنيسة الأوروبية المتخلفة والغاشمة الظالمة !!!..
    وهكذا هي كل شبهة للملاحدة وغيرهم تكون قائمة على الكذب أو الخطأ أو عدم الأمانة :
    فهي تربك المسلم العادي في أولها .. وإلى أن تنفتح عيناه على الحق بإذن الله ..

    < حاولت الاطلاع على دائرة المعارف هذه لأعرف أصل الخطأ : هل هو من كاتبها النصراني : أم تعمد تحريف من إسماعيل مظهر : ولكني للأسف لم أحصل إلا على المجلد الأول فقط منها ولم يكن قد انتهى بعد من حرفي الألف والباء التي تليه !! >

    وهنا قام دكتورنا الفاضل حسام الدين حامد في موضوعه : (( وإذن : ليس أصل الإنسان سمكة )) :
    http://www.eltwhed.com/vb/showthread...%D3%E3%DF%C9!!

    قام بنقل أصل كلام وعقيدة أنيكسمندر ..
    < ولاحظوا فرق المعنى بين ما ستقرأونه الآن : وما قام بنقله إسماعيل مظهر > :
    فأنيكسمندر هو :
    " أعظم أعلام المدرسة الأيونية منزلةً، وأوسعها شهرةً، وأكبرها أثرًا " ..
    المصدر : الانقطاعات المعرفية في الفكر الفلسفي اليوناني حتى عصر أرسطو – سمر سمير أنور – صفحة 46.

    وأما فكرته الحقيقية فهي :
    " أنه يرى أن الحيوانات جميعًا كانت بدايتها في المياه محاطةً بلحاءٍ شائك، وبعد ذلك انتقلت إلى الأجزاء اليابسة من الأرض فانشق عنها اللحاء، وعاشت على الأرض حينًا من الزمن، استبقت فيه نوعها بالتناسل، ولما كان الإنسان يختلف عن هذه الكائنات، من جهة كونه لا يستطيع حماية نفسه في صغره، ويحتاج إلى سنين عديدةٍ ليستطيع القيام بشأن نفسه، وبالتالي فخروجه إلى اليابسة رضيعًا دون أسرةٍ تحميه، يعني أنّه سيموت فينقرض نوعه وهذا ما لم يحدث، خرج أنكسيمندر من هذه المعضلة باستثناء الإنسان من هذا العموم، فزعم أن الإنسان نشأ عن الأسماك، بعد أن ظل في جوفها حتى بلغ سنًّا يؤهله، لحماية نفسه والتكاثر ثم حماية نسله، وليس هناك ما يمنع أن يكون أنكسيمندر قال بهذا القول في سائر الحيوانات، التي يعجز صغارها عن رعاية نفسها في وقتٍ قصير، ولكنّ الذي بلغنا هو قوله في الإنسان وحسب " !!!..
    المصدر : The Presocratic Philosophers – Jonathan Barnes – P 15

    والفرق طبعا ًواضح أنه حتى ذلك الفيلسوف الإغريقي بفكرته الأسطورية الخرافية تلك : لم يدع نشوء الكائنات الحية من لا شيء ثم تطورها من بعضها البعض !!!..

    9...
    وبمثل هذه المقدمة الغير صحيحة لإسماعيل مظهر : سواء في ادعاءاته على مشاهير الإسلام : أو عدم تحريه (( بنفسه )) ما نقله عن الفيلسوف الإغريقي لأهميته : فضلا ًعن ادعاءه كذبا ًأنه يسبق ذلك حتما ًفي التاريخ الإنساني الكثير مثله : أقول بتلك المقدمة الغير صحيحة :
    فقد تأثر بها الكثيرون للأسف ممَن وثقوا بأدعياء الثقافة والتعلم والتحضر والمدنية الغربية !!!..
    وإلى أن سار على نفس النهج في التزييف والتحريف وغمز عقيدة الخلق الإلهي :
    المشروع الثاني لترجمة الكتاب تحت عناية العلماني جابر عصفور المصري ..
    ومعها مقدمة تفخيمية بأسلوب النفخ في التراب للنصراني : سمير حنا صادق : حتى وصل به التفخيم إلى أن نسب لنظرية داروين - والتي قال أنها صارت حقيقة علمية لا شك فيها بتاتا ً- نسب إلى تلك النظرية المتهافتة كل إنجاز علمي وطبي اليوم تقريبا ًفي استخفاف عجيب بعقل القاريء !!!!..
    ثم أكمل على نفس اللحن مترجم الكتاب : العلماني أو التغرييبي أو الحداثي : مجدي محمود المليجي ...
    -------------------
    ---------------------------

    وهنا أقف قليلا ً...
    وأعتذر في كل ما سبق : إن كنت قد أطلت و (( رغيت )) شوية معاكو أخي الحبيب بحب ديني ...
    ولكنها الرغبة في نقل صورة أكثر اتساعا ًلكل مَن لا خبرة له بأساس المسألة !!..

    وفي الجزء التالي :
    أستعرض معكم ومن كلام داروين نفسه : مَن سبقه في العصر الحديث بفكرة النشوء والارتقاء للكائنات الحية ..

    يُـتبع بعد قليل إن شاء الله ...
    ---------


    10...
    في الترجمة الثانية لكتاب داروين : أصل الأنواع : وهي التي لمجدي محمود المليجي : واسمها :
    (( أصل الأنواع ..
    نشأة الأنواع الحية : عن طريق الانتقاء الطبيعي أو :
    الاحتفاظ بالأعراق المفضلة : في أثناء الكفاح من أجل الحياة
    ))
    فقد أوردوا من الصفحة 37 : نبذة تاريخية كان قد كتبها داروين قبل نشر الطبعة الأولى من كتابه :
    عن : تطور المعتقدات حول نشأة الأنواع الحية ...
    حيث ذكر عددا ًكبيرا ًممَن سبقوه بالقول بكل أساطير وفرضيات التطور كما سنرى :
    وكيف أنهم لما كان منتشرا ًبينهم خرافة (( التوالد التلقائي )) للكائنات الحية أو العضوية : ولو من الجمادات !!..
    فاستخفوا - ومعهم داروين - بنشوء أول كائن حي أو عضوي أو غيره في تدرجه المزعوم !
    وصار كل عالم منهم يضع خيالاته وافتراضاته في إطار نظرية أو فكرة أو مقال كما سنرى !!!..
    حيث كان يُظن في ذلك الوقت مثلا ًأن الحشرات : تنشأ من بقايا الطعام لو تركتها لفترة !!..
    ويُظن أن الفئران : تنشأ من الشعير !!..
    ويُظن أن البكتيريا : تنشأ من الجمادات !!..
    ويُظن أن اليرقات : تنشأ من قطع اللحم !!..
    ولم ينتبه هو ومعاصريه إلى أن الذباب مثلا ً: كان هو الذي يجلب هذه اليرقات للحم !!..
    تلك اليرقات الصغيرة جدا ًوالتي لا ترى بالعين المجردة !!..
    وإلى أن قضى لويس باستير على كل هذه السفاسف بعملية البسترة وبعد كتابة داروين لكتابه ..
    والآن ...
    تعالوا نذكر أولئك الذين قرأ لهم داروين وتابعهم وأخذ عنهم أفكاره :

    1...
    أرسطو : ونسب إليه فكرة التطور .. وساق مثالا ًغبيا ًجدا ًلأرسطو عن اختلاف شكل الأسنان مع وظيفة كل منها (الضروس والأنياب والقواطع إلخ) .. والكلام كله لا وزن له من العلم .. وليس فيه تصريح ٌبالتطور بمفهوم داروين أصلا ً.. فضلا ًعن أن المشهور عن أرسطو هو ثبات الأنواع : ويُرجى قراءة ذلك من رابط موضوع الدكتور حسام الأول الذي وضعته لكم : أو من رابط مدونتي الذي وضعته لكم أيضا ً...

    ثم انتقل داروين مباشرة للحديث عن القائمة الحديثة :
    ونلاحظ أنهم كلهم نتاج عصر كره للكنيسة : حيث دفعهم للرغبة في التملص من أوثق عقائدها الدينية وهي عقيدة الإله الخالق : لمعرفتهم بالتأثير المباشر لذلك على الإلحاد والتمرد بالتالي على سيطرة الكنيسة في أوروبا في ذلك الوقت حتى على العلم ..
    وتعالوا لنرى معا ً: مَن ذكرهم داروين في العصر الحديث :

    2...
    حيث ذكر بوفون Buffon .. وذكر أنه أشار إلى تحولات الكائنات الحية من بعضها إلى البعض : ولكنه كان متقلبا ًفي رأيه هذا مترددا ً: ولم يذكر أو يقترح أي وسيلة لهذا التحول (مثل القول بأنه نتيجة طفرات أو تحورات لملائمة الطبيعة إلخ) .. ولهذا لم يقف داروين عنده كثيرا ً- هكذا قال داروين -

    3...
    ثم يأتي الدور الأكبر في لفت النظر إلى النشوء والإرتقاء في الكائنات الحية وتحولها : إلى العالم لامارك Lamarck !!!.. حيث يصفه داروين بأنه أسدى ( خدمة جليلة ) بلفت النظر لأن التغييرات التي تحدث في العالم العضوي وحتى الغير عضوي : يمكن جدا ًأن تكون نتيجة قانون : وليس لتدخل إعجازي !!! - يقصد تدخل إلهي : وهو نفس ما سار عليه داروين في كل كتابه وصرح به في أكثر من موضع ومنها عند حديثه عن العين - ..
    وقد أعلن لامارك عن أفكاره لأول مرة عام 1801م ..
    ثم زاد عليها وأضاف إليها في كتابه (الفلسفة الحيوانية) عام 1809م ..
    ثم ختمها بكتابه (التاريخ الطبيعي للحيوانات الفقارية) 1815م ..
    وأشار داروين إلى تأثر لامارك في أفكاره هذه عن تحول الكائنات من بعضها إلى البعض - بما فيها الإنسان - إلى ملاحظات لامارك للعديد من التشابهات بين الكائنات الحية وما يحدث في التهجين من خلط للصفات إلخ ...
    وأما الوسائل التي ذكرها لامارك لهذا التحول - والنشوء والارتقاء بحد تصريح داروين - فهي :

    1-
    التأثير المباشر للعوامل الطبيعية ..
    ويقصد به أن تؤثر الطبيعة على الكائن الحي : فتتحور أعضاؤه ليتكيف معها : فيتطور ويترقى إلى كائن آخر مختلف في الصفات !!.. ثم يورث ذلك إلى أبنائه !!!.. وكل هذه الفكرة البلهاء تم نسفها تماما ًفيما بعد على يد العالم (وايزمان) وتجربته الشهيرة في قطع ذيول الفئران لمدة 19 جيل !!!.. أي بما يعادل 570 سنة في عمر البشر : وكانت تولد الفئران بذيول في كل مرة !!!.. بل نحن كبشر - وكمسلمين تحديدا ً- : نختن أولادنا الذكور لمدة زادت عن الـ 1400 سنة : وفي كل مرة يولد ذكورنا غير مختونين !!!..
    وهذه القاعدة العلمية الوراثية المعروفة اليوم اسمها :
    (( الصفات المكتسبة (أي في حياة الكائن الحي) لا تورث (أي إلى أبنائه) ))
    فالنجار والحداد يكتسبون قوة العضلات مثلا ًفي حياتهما : ولكنهما لا يورثونها لأبنائهما من بعدهما !!!..

    2-
    وأما الوسيلة الثانية فهي التهجين ..
    حيث وقع لامارك في نفس الخطأ الذي تبعه فيه داروين وهو : اعتقادهم ( عمياني كده ) أن التهجين في يوم من الأيام ومع طول الزمان : قد ينتج أنواعا جديدة من الحيوانات !!!.. وهذه خرافة بالطبع : لا تقل في سماجتها عن الوسيلة الأولى التي اقترحها لامارك !!!..
    لأن التهجين ومهما كان : فهو ينتج أبناء : من نفس النوع ولا يخرج عنه !!!..
    فالحصان العربي الأصيل يتم تهجينه مع حصان أوروبي أو غيره : فينتجان حصانا ًوليس أسدا ًمثلا ً!!!..
    بل وحتى إذا اتسعت الدائرة : فقمنا بتهجين حصان مع حمار : فينتجان بغلا ً: ويكون دوما ًمقطوع النسل أي لا يلد !!!..
    ولا ينتجان مثلا ًقردا ًولا غوريلا !!!..
    وحتى لو لقحنا هذا البغل صناعيا ًمع غيره : فلن يخرج عن دائرة الحصان والحمار والبغل !!!..
    ولمزيد من المعلومات الهامة جدا ًعن حدود التهجين : أرجو قراءة الرابط التالي :
    هل إمكانية التهجين : تدل على التطور ؟؟؟..
    http://abohobelah.blogspot.com/2012/06/6_4690.html
    والسبب في كل ذلك :
    أن لكل نوع من الكائنات الحية : ما يعرف بالحوض الجيني الخاص به : والذي لا يمكن أن يتعداه إلى غيره : إلا ميتا ً(كمَن يحاول تلقيح كلب بحمار أو قط بدجاجة إلخ فيموت الجنين أو الوليد المشوه) .. ويمكن مطالعة الرابط التالي أيضا ًلمزيد المعلومات عن الحوض الجيني : العقبة الكؤود أمام الداروينيين والتطوريين :
    http://abohobelah.blogspot.com/2012/06/6.html
    ومن هنا :
    يتبين لنا خبث الداروينيين الجدد والتطوريين عندما قاموا بتسمية التهجين وما ينتج عنه من تغيرات في الصفات بـ : التطور الأصغر microevolution وذلك ليوحوا للعوام والبسطاء والجهال أنه يمهد بالتأكيد ويدل على التطور الأكبر macroevolution !!!..
    وكل ذلك من خبثهم العلمي والإعلامي بالطبع ...
    ونعود إلى لامارك في تخبطه وعماه : ومع الوسيلة الثالثة عنده للتحول وهي :

    3-
    الاستخدام وعدم الاستخدام ..! أو : الاستعمال والإهمال ..!
    ويقصد بها : أن العضو الذي يُستخدم كثيرا ً: ينمو ويطول أو يتضخم .. والذي لا يُستخدم : يتضاءل ويتصاغر أو يتلاشى ..
    وأشهر مثال على ذلك ساقه هو : طول عنق الزرافة التي كانت في الأصل قصيرة العنق !
    ولكنها عندما أكثرت من مد عنقها لأعلى : استطال إلى الشكل الذي نراه الآن !!!..
    وبالطبع هذه الخرافة الثالثة هي الأخرى : تلتحق بأختيها السابقتين في مزبلة التاريخ والعلم !
    فلا حفريات الكائنات الحية المكتشفة تثبتها ...! ولا أي فرع محترم من فروع علم الأحياء !!!..
    < ملحوظة : يُطلق على آثار الكائنات الحية الميتة منذ آلاف السنين وأكثر : اسم حفريات : ومثلها المتحجرات >
    فحفريات كل كائن حي منذ ملايين السنين باعترافهم أنفسهم : هي هي مثلها مثل نفس ذلك الحيوان اليوم !!!..
    وأما المفاجأة التي لا يعرفها الكثيرون :
    فهي أن داروين نفسه كان متأثرا ًبأفكار لامارك الساقطة تلك - فالذي باع عقله للتنصل من ربه : تستهويه أي فكرة بالغة ما بلغت من التفاهة - وفي الرابط التالي تجدون الأدلة من كتاب داروين نفسه أصل الأنواع :
    http://abohobelah.blogspot.com/2012/...g-post_21.html
    وبذلك ننتهي من لامارك ..
    أشهر أوائل مَن أثاروا فكرة التحول في الكائنات الحية : وتأثر بها داروين ..

    4...
    جيوفروي سانت هيلاري Geoffroy Saint-Hilaire .. وقد نشر ابنه كتابا ًعن حياته : أخبر فيه بأنه بدأ بالشك ربما عام 1795م في أن ما يسميه الناس أنواعا ًمن الكائنات الحية : ما هي إلا تطورات من بعضها البعض !!!.. ولكنه لم ينشر من ذلك شيئا ًإلى أن جاء عام 1828م .. وفيه صرح بأعتقاده أن الكائنات الحية لم تكن هكذا منذ أن وُجدت !!.. ويُرجع داروين ذلك الرأي لجيوفروي : لنظرته لتأثير البيئات على الكائنات الحية - أي تقريبا ًنفس الوسيلة الأولى التي قال بها لامارك - ..
    ولكنه - ويا للغرابة - ولكي يهرب من أي محاولة لتخطئته قال : أنه لا يعتقد أن الكائنات الحالية الآن تمر بنفس التحول !!!..
    وأن هذه مشكلة المستقبل - على حد تعبير ابنه - !!!..

    5...
    الدكتور و. س. ويلس W. D. Wells .. وهو الذي أخذ عنه داروين فكرة الانتخاب أو الانتقاء الطبيعي !!!.. ولكن لمع نجم داروين لشبابه ربما وتوسيعه للقاعدة لتشمل كل الكائنات الحية والصفات : بخلاف ويلس الذي قصر ذكرها على الإنسان وعلى بعض الصفات التي ذكرها في هذا الصدد فقط !!..
    حيث في عام 1813م ألقى الدكتور ويلس أمام الجمعية الملكية بحثا ًعنوانه :
    (( وصف لأنثى بيضاء : يتشابه جزء من جلدها مع جلد أي زنجي )) !!!.. ولكن لم يتم نشر البحث حتى ظهور كتابه (( مقالتان عن الرؤية المبهمة والرؤية الواضحة )) عام 1818م !!.. وهو الذي أظهر فيه الإشارة إلى الانتقاء الطبيعي : حيث تنتقي الطبيعة الزنوج والأخلاس (الأخلاس هم الخلطاء مثل المولود لزنجي وبيضاء مثلا ً) : تنتقيهم الطبيعة في المناطق الحارة لأنهم لديهم المناعة ضد بعض أمراض تلك المناطق !!!..
    ويفرقه عن داروين كما قلنا : أنه قصر حديثه هنا على البشر وبعض صفاتهم تحديدا ً!!.. بعكس داروين الذي توسع في تطبيق الفكرة : فكان هذا سبب التصاقها به في شهرته على ما يبدو ...
    ولكن اتفق ويلس أيضا ًمعه في ملاحظته لـ :
    1- أن الكائنات الحية تختلف اختلافات وتمايزات ولو إلى درجة ما فيما بينها ..
    2- أن المزارعين يقومون بالتهجين لتحسين حيواناتهم الداجنة بانتقاء السلالات وتزويجها ..
    فأشار ويلس إلى أن هذا الانتقاء هو ما تقوم به الطبيعة : ولكن بطريقة أكثر بطءا ً!!!..
    وأقول أنا أبو حب الله :
    إن كان الرجل صدق فيما افترضه لمحاولة تفسير تمركز الزنوج في المناطق الحارة : فقد كذب والله في نسبته الانتقاء للطبيعة !!.. فلا الطبيعة لديها كيان : ولا علم : ولا حتى إدراك للتمييز ولا اختيار : فضلا ًعن عجزها التام عن إنشاء هذه المخلوقات ابتداء ً: ثم تمايزاتها وتنوعاتها في كل حيوان ليلائم طبيعته تماما ًبتمام !!!.. ولكنه رب العالمين سبحانه ...
    وجدير بالذكر أن تفسير الدكتور ويلس لتمركز الزنوج في المناطق الحارة : قد قام بمثله لتفسير تمركز البيض في المناطق الباردة أيضا ً..
    وقد أشرت أنا لقريب من هذه المسألة قرب نهاية الصفحة التالية :
    http://abohobelah.blogspot.com/2012/08/6_11.html

    >>>
    وهنا .. ومنعا ًللتطويل والتكرار بغير داعي ...
    فسوف أذكر (باختصار) مجموعة ما ذكره داروين بعد ذلك من مجموعة علماء في النباتيات وغيره : اتفقوا على عدة مباديء تمهد لفكر داروين .. سواء استخفافهم بإعجاز الحياة نتيجة فكرة التوالد التلقائي ونشوء الحياة وتحولها ولو في مستنقع آسن هكذا وبعيدا ًعن التعقيدات !!.. وأن الأنواع التي نتجت من التهجين في فترات من الزمن - نباتية أو حيوانية - : هي التي صارت بعد ذلك أنواعا ًثابتة : ولكنها غير قابلة للتهجين من جديد !!!.. إلى آخر هذه الافتراضات عن النشأة الأولى للكائنات وتحولها : والتي إن أردنا أن نجمع آراءهم كلهم على جملة واحدة بما فيهم داروين ومَن بعده إلى اليوم لقلنا :
    (( الخيال المحض الذي لا دليل عليه إلى الافتراض للتملص من الخلق المباشر من الله عز وجل ))

    وهؤلاء الذين ذكرهم داروين في نبذته قبل صدور أول طبعة من كتابه عام 1859م هم :
    (وسوف أضع معهم : اسم وعام أشهر ما كتبوه واستدل به داروين) :

    6...
    1822م : و. هيربرت W. Herbert
    الجزء الرابع من موسوعته (المعاملات البستانية) وكتابه عن (الفصيلة النرجسية)

    7...
    1826 - 1834م : الأستاذ جرانت Prof. Grant
    الفقرة الاستخلاصية من مقاله عن (الإسفنجيات) - محاضرته الـ 55 في مجلة (لانسيت)

    8...
    1831م (مكتوبة بالخطأ 1931م) - 1860م : باتريك ماثيو Patrech Matthew
    بحث عن (الأخشاب المناسبة للبحر وزراعة الأشجار)

    9...
    1836م : فون بوش Von Bush
    كتابه (الوصف المادي لجزر الكناري)

    10...
    1836م : رافينيك Rafinesque
    كتابه (الحياة النباتية الجديدة في أمريكا الشمالية)

    11...
    1843- 1844م : هالديمان Haldeman
    الجزء الرابع من مجلة (بوسطن للتاريخ الطبيعي للولايات المتحدة)

    12...
    1844م : كاتب مجهول
    في الطبعة العاشرة 1853م من كتابه (الآثار المتبقية من الخليقة) ص 155 :
    حاول دمج التطور والتغير بالعناية الإلهية - مثلما يحاول بعض المسلمين اليوم - .. وقد نقده داروين - رغم سعادته به لإثارته للموضوع أصلا ًفي بلد مثل انجلترا في ذلك الوقت كتمهيد لما سيأتي - قد نقده داروين في حصره لأساليب التغير بالطفرات !!.. وبثبات الصفات المكتسبة من الطبيعة !!.. وضرب داروين مثالا ًعلى تلك الصعوبة في تخيل التطور بالطفرات المفاجئة مثلا ًبأن تخرج لنا طائرا ًمثل نقار الخشب !!!..
    < ولذلك نجد الداروينيين والتطوريين بالانتخاب الطبيعي : دوما ًضد القائلين بالتطور بالطفرات >

    13...
    1846م : م. ج. دوماليوس دهالوي M. J. d'Omalius d'Halloy
    بحث له في (نشرات معهد بروكسل الملكي - الجزء 13)

    14...
    1849م : أوين Owen
    كتابه (طبيعة الأطراف) - خطابه إلى (الجمعية البريطانية) 1858م
    وهو الشخص الذي انخدع به داروين حيث كان يظنه ممَن يعولون على ثبات الخلق الإلهي وانفصال كل حيوان عن الآخر : ثم تبين له أنه لم يكن يقصد بتعبيره : (العملية المستمرة للقوة الخالقة) أنه معها !!.. ولكنه قصد أن المؤمن بها لن يستطيع تفسير غرائب الكائنات الحية مثل قصر وجود طائر الكيوي في نيوزيلنده .. وكذلك حالة طائر الطهيوج الأحمر !!.. وهو ما ظهر أكثر في كتابه بعد ذلك (علم التشريح الخاص بالفقاريات) .. حيث اعترف بأن الانتقاء الطبيعي قد يكون له تأثير في تكوين نوع جديد : مع اعترافه بأن ذلك لا دليل عليه أو غير صحيح !!!..
    وقد اشتكى أوين : أنه قال بالانتقاء الطبيعي قبل داروين !!!..
    ودافع داروين عن نفسه أن كتابات اوين نفسها صعبة ومتضاربة أحيانا ً..
    وفي النهاية : يعلن داروين أنه سواء هو أو أوين :
    فقد سبقهما للقول بالانتقاء الطبيعي كل ٌمن : الدكتور ويلس : والأستاذ ماثيو !!!..

    15...
    1851م : الدكتور فريك Freke
    دورية صادرة له من (مطبعة دبلن الطبية) : أعلن عن احتمال انحدار جميع الكائنات العضوية من شكل واحد بدائي !
    ولكن داروين يقول أنه يختلف معه في الخلفيات الخاصة بإيمانه وبطريقة معالجته للموضوع !!..
    وله مقالة 1861م بعنوان (نشأة الأنواع الحية عن طريق الصلة العرقية العضوية)

    16...
    1852- 1858م : هيربرت سبينسر Herbert Spencer
    مقالة له في مجلة (القائد) للمقارنة بين نظريات الخلق : والنشوء والارتقاء .. ثم افتراضه تحول الكائنات تأثرا ًبالبيئة

    17...
    1852م : م. نودين M. Naudin

    مقالته عن (نشأة الأنواع الحية) عزى الانتقاء لما أسماه (القوة المطلقة) ولكنه لم يفسر آلياتها الطبيعية ..

    18...
    1853م : الكونت كيسرلنج Count Keyserling

    فكرته التي اقترحها في المجلد الثاني - الجزء العاشر من (نشرة الجمعية الجيولوجية) وهي أنه كما أن أمراضا ًجديدة قد نتجت من بعض الأبخرة العفنة المنبعثة من مستنقع : فظهرت للوجود بعد أن لم تكن موجودة : ثم انتشرت : فكذلك يمكن أن يكون قد حدث تأثير كيميائي على بذور الأنواع الحية الأولية : فأنتجت أشكالا ًجديدة من الكائنات الحية : هي الموجودة حاليا ً!!!..

    19...
    1853م : الدكتور شكافهوزن Schaaffahausen

    نشر كتيبا ًعن (نشوء وتطور الأشكال العضوية على الكرة الأرضية)

    20...
    1854م : م. ليكوك M. Lecoq

    كتب الجزء الأول من (التعلم في الجغرافيا النباتية) ..

    21...
    1855م : بادن بويل Baden Powell

    تحدث عن رؤيته الجديدة عن فلسفة الخلق في مقالاته عن (اتحاد العوالم) .. وذهب فيها إلى أن نشوء أنواع الكائنات الحية هو عملية نظامية وليست عرضية : أو هي عملية طبيعية : ولا تخضع للعمليات الإعجازية !!!..

    22...
    1850م : فون بير Von Baer

    صرح بفكرته أن الأشكال الحية المختلفة حاليا ً: لم تكن إلا لشكل أبوي واحد في الماضي !

    23...
    1859م : الأستاذ هكسلي Prof. Huxley

    ألقى محاضرة أمام (المؤسسة الملكية) عن (الأنماط الدائمة الخاصة بالحياة الحيوانية)

    24...
    1859م
    (مكتوب بالخطأ 1895) : الدكتور هوكر Hooker
    كتابه (مقدمة إلى الحياة النباتية الأسترالية) يقول فيه بالنشوء وتعديلات الأنواع

    25...

    وأخيرا ً: ولأكثر من مرة خلال كل ذلك : يعترف داروين بأسبقية والاس إلى القول بالانتقاء الطبيعي ... ويذكر أن ذلك موجود في الجزء الثالث من (جريدة الجمعية اللينيائية) .. وسميت كذلك نسبة ًإلى عالم النبات السويدي كارل فون ليني ..
    ------------

    وهكذا نرى أن داروين : لم يكن مبدعا ًعلى قدر ما كان ناقلا ًومُجمعا ً: تحذوه مشاعره الإلحادية للتملص من سلطان الخالق عز وجل : مثله مثل أكثر مَن تأثر بهم في أفكاره تلك ..
    وهذا رابط يبحث في إيمان داروين وإلحاده :
    http://abohobelah.blogspot.com/2012/06/6_1219.html

    وقد رأينا معا ًكيف أن ذلك القرن التاسع عشر : وفي الخمسين عاما ًبالضبط التي سبقت صدور كتاب داروين
    الأول في التطور أصل الأنواع (لأنه له كتب أخرى ورسائل علمية سابقة .. ثم له كتاب ثاني عن التطور أكثر خرافة وسماجة وابتذالا ًوغباءً من أصل الأنواع وهو : أصل الإنسان)
    : في هذه الخمسين عاما ًكانت واضحة ٌجدا ًتلك الإرهاصات التي تنتظر ولادة إلحادية لتجمع كل هذه التخرصات والأكاذيب والفرضيات المتهافتة : وتسلكها في فرضية واحدة تخرج للناس في شكل نظرية علمية براقة خادعة - فلو لم يكن داروين لكان غيره ! - : ولكن تميز داروين عن غيره بـ :
    1-
    قوة الدافع الداخلي - والتي تظهر بوضوح في تخطيه عمدا ًعلى عشرات الصعاب والمستحيلات في نظريته : مهونا ًإياها وموحيا ًبأنها لن تهدم نظريته إلا القليل منها الذي لم يستطع أن يماطل فيه مثل معضلة عدم كشف المستقبل على ملايين الحفريات الانتقالية والتغيرات المفترض أنها حدثت لتنتقي منها الطبيعة الأصلح : وهو ما لم ولن يتحقق وإلى اليوم - ..
    2-
    خبرة مشاهداته الواسعة لمختلف الكائنات الحية في رحلاته البحرية الطويلة ...
    3-
    تعميماته لأسس فرضياته لتشمل ظهور الحياة على شكل الأرض مرورا ًبكل صورها : مما أكسبها عمومية لنظريته افتقدها غيره كما رأينا بالأعلى ..

    وأعتذر مرة أخرى على الإطالة ...
    وأرجو أن أكون بهذا قد أعطيت كل مَن يحتاج :
    المقدمة الكافية له ليعرف عن ماذا تدور أفكار التطور وكيف نشأت ..

    والله الموفق ...


  8. #128

    افتراضي

    نعم انه يؤمن بها البعض من المسلمين { مثل الشيخ الجسر ..وغيره.} من خلا كتاب { قصة الايمان بين العلم والفلسفة والقرءان .

  9. #129
    تاريخ التسجيل
    Sep 2011
    المشاركات
    728
    المذهب أو العقيدة
    مسلم

    افتراضي

    اقتباس المشاركة الأصلية كتبت بواسطة 3arfa مشاهدة المشاركة
    نعم انه يؤمن بها البعض من المسلمين { مثل الشيخ الجسر ..وغيره.} من خلا كتاب { قصة الايمان بين العلم والفلسفة والقرءان .
    لم يكتب أحد المسلمين في محاولة التوفيق بين هذه النظرية الساقطة والإسلام إلا في العصر الحديث , حيث انخدع البعض بأكاذيب التطوريين , ونرجو منك الالتزام بموضوعك الذي سنرى فيه صحة بديهاتك أولا
    الليلة سيحاورك أحد الأخوة الأفاضل إن شاء الله
    التعديل الأخير تم 08-26-2012 الساعة 05:42 PM

  10. #130

    افتراضي

    إخواني الكرام ...
    قد راسلني أحد الأخوة الأحباب منذ أيام بخصوص شبهة التحام الكروموسوم 2 في الإنسان ..
    وهي شبهة يلوكها الملاحدة والتطوريون كثيرا ًويبررون بها نقص كروموسومات الإنسان عن باقي عائلته والشيمبانزي ممثلين للأصل المشترك المزعوم (حيث أن عدد أزواج كروموسوماتهم 48 وعدد أزواج كروموسومات الإنسان 46) ...

    وكنت على وشك الانتهاء من الرد منذ ساعتين .. ولكن هناك بعض الأعطال في الجهاز للأسف - وذلك سبب أن رأى بعضكم مسودة الرد منذ ساعة ولم تكتمل .. وقد وضعتها بالخطأ ثم حذفتها الآن -
    والشاهد :
    أني قد وعدت هذا الأخ بوضعها الليلة بإذن الله تعالى ...
    ولكن قد أتمكن من ذلك وقد لا أتمكن بسبب ذلك العطل .. فيكون الغد بإذن الله تعالى ..
    والله الموفق ...
    التعديل الأخير تم 08-28-2012 الساعة 10:03 PM

  11. #131

    افتراضي

    متفرقات ...
    نسف شبهة التحام الكروموسوم 2 أثناء تطور الإنسان من سلف القرود !!..

    وهي شبهة يتداولها الملاحدة كثيرا ً.. ويلوكونها - كعادتهم - في كل حوار يريد الجهبذ منهم إثبات أحد أدلة التطور ( الدامغة ) !!!..
    وذلك كما سترون في المشاركة القادمة لنسف شبهة العصب الحنجري في الزرافة أو غيرها من الكائنات الفقارية ..

    ولعل العامل المشترك بين تلك الشبه جميعا ً: هي أنها لا تنطلي ولا تمر إلا على جاهل بعلومها أصلا ً: سواء علوم التشريح أو البيولوجيا الجزيئية إلخ ..
    فأما المسلم :
    فيحترم جهله بما لا يعلمه .. ولكنه على يقين من ربه : فينتظر ظهور الحق أو يسأل ..
    وأما الملحد :
    فيتبختر بجهله على غيره إلى أن يصدمه الله تعالى بالحقيقة المرة :
    فيختفي ساعتها الملحد ويهرب :
    ليبدأ رحلة بحثه عن شبهة ساقطة جديدة يتمسك بها لعلها تعطيه بعض التبرير لكفره بالله عز وجل خالقه !!..

    لن أطيل عليكم ...
    وكعادتي : فسوف أعطي مقدمة ومعلومات عن موضوع الشبهة : وحتى يستطيع الكل - مسلم وملحد - أن يعرف عما نتحدث :
    ويكتشف بنفسه سماجة أفكار الملاحدة وتفاهتها عندما يعلم الجمهور بحقائق ما يتحدثون عنه !!!..
    ---------

    1...
    التطوريون كلهم غشاشون وكذابون ومخادعون وبكل جراءة ( هذه قاعدة لا تنسوها أبدا ً)

    2...
    وليس لهم إلا الفرضيات والخيالات والسيناريوهات المضحكة لتفسيراتهم المتعلقة بالتطور ...
    وأغلبها يعتمد على التشابه الشكلي (الخارجي) للكائنات الحية !!!..

    يعني لتقريب الفكرة مثلا ً( وأرجو عدم الضحك ) :
    لديهم الغش في رسم وتخيل وافتراض الأشكال البينية بين أي حيوانين لتفسير التطور :



    مثال :
    من سمكة بحرية إلى ضفدع برمائي (وبقدرة قادر !) إلى سحلية زاحفة : إلى أرنب ثديي !!
    وكما في الصورة التالية :



    ولديهم القدرة أيضا ًما شاء الله على التخيل في الاتجاه المعاكس (أي من البر إلى البحر) !
    من دب يسبح : إلى حوت يفوقه عشرات المرات في الحجم !!.. ويختلف عنه تماما ًفي البنية !



    أو حتى مثل هذه من الديناصورات إلى الطيور (بقدرة قادر !) :



    أو حتى من سمكة الكوالاكينت إلى تمساح !!!..



    وأخيرا ً( ولاحظوا شدة التشابه هذه المرة ) :

    بين الشيمبانزي :



    وابن عمه - في دينهم - : الإنسان !!!..



    وبغض النظر عن استحالة ذلك فسيولوجيا ًوعلميا ًومنطقيا ًوتميز الإنسان الشديد !
    http://abohobelah.blogspot.com/2012/06/1.html



    وبغض النظر عن فضائح غشهم وخداعهم المتتالية بشأن الحفريات البينية :
    سواء للإنسان :
    http://abohobelah.blogspot.com/2012/06/1.html

    أو غيره مثل الحيتان والتي وضعوا لها زيادات غير حقيقية في متاحف التطور وباعترافهم !
    http://abohobelah.blogspot.com/2012/06/6_9100.html

    وهكذا نجد كذباتهم : لازالوا يستبقونها في كتبهم ومواقعهم وحتى الويكيبديا : بغير حياء !...

    3...
    وعندما انهارت أحلامهم على عتبة البيولوجيا الجزيئية وحقائق الحمض النووي المذهلة DNA :
    وأن لكل حيوان شيفرته الوراثية المميزة داخل كل خلية من خلاياه :
    لم ييأسوا !!!!..
    < يعني يضيع الإلحاد يعني ولا إيه ؟!!.. >

    ولكن قرروا استغلال السلاح القاتل الذي عليهم : لصالحهم !!!..

    فماذا قرروا ؟!!!..

    لقد نظروا بالطبع على أعلى قضاياهم أهمية في الكفر والإلحاد وهي الإنسان وابن عمه الشيمبانزي :
    واللذان ينسباناهما لجد ٍواحد وأصل واحد مشترك في زعمهم ...
    فماذا واجدوا ؟!!!..

    نظروا في جدول عدد كروموسومات الكائنات الحية (ليس كلها بالطبع ولكن عددا ًمنها) ...
    < وتسمى الكروموسومات بالصبغيات : لأن العلماء لما يريدون رؤيتها داخل الخلية المعقدة يصبغونها لتمييزها >



    فالصورة أعلاه تبين زوجين من كل كروموسوم ...
    (في خلايا الجسد 46 كروموسوم وفي الخلايا الجنسية 23) وإليكم التفصيل :



    حيث الكروموسوم أو الصبغي الواحد : هو نصف شكل الـ X الذي ترونه في الصورة أعلاه .. ويتكون الصبغي الواحد من زوجين من الكروماتيد : مشدودان من المنتصفتقريبا ًوهو ما يعطي لزوجي الكرومسوم شكل الـ X المميز ولكنهما غير متقاطعتين .. وتحتوي خلية الإنسان الجسدية على 46 كروموسوم (آخر زوجين هما الكروموسومين الجنسيين : xx في حالة الأنثى و xy في حالة الذكر) .. وتتفاوت الكروموسومات في الطول والشكل إلى أربعة أنواع رئيسية : وكما هو مشروح في منتصف الصورة .. ولكل كروموسوم ذراع قصير (يرمزون له بـ p) وذراع طويل (q) ..

    أقول : فلما نظروا في جدول عدد كروموسومات تلك الكائنات الحية :



    وجدوا (وكما ترون في أسفل يمين الصورة أعلاه : الشيمبانزي والإنسان) :
    وجدوا الشيمبانزي يملك في خلاياه : 48 كروموسوم .. والإنسان يملك : 46 ..!!
    يبقى بس .. اتحلت ...

    ده شبه ده !!!.. < وبنفس منطق الصور التطورية الخرافية التي سقتها لكم بالأعلى >

    ونسي الجهابذة أن المسألة لو بعدد الكروموسومات :
    فنبات البطاطا يملك 48 كروموسوم مثل الشيمبانزي !!.. فهل البطاطا شبهنا برضه أو حتى شبه الشيمبانزي ؟!
    وأحد أنواع الأرانب (jack rabbit) لديه أيضا ً48 كروموسوم مثل الشيمبانزي : فهل يشبهنا أيضا ًأو يشبه الشيمبانزي ؟!
    بل - ودعونا من عدد الـ 48 كروموسوم : وخلينا في عدد يطابق عدد كروموسوماتنا الـ 46 - :
    فأحد أنواع الغزلان (Reeves's Muntjac) يملك مثلنا عدد 46 كروموسوم !!.. فهل يشبهنا ؟!!!..
    وكذلك أحد أنواع الظباء (Sable) : لديه 46 كروموسوم مثلنا !!.. فهل يشبهنا أو ابن عمومتنا هو أيضا ً؟!!..

    معضلة .. صح ؟؟..

    ومن هنا ...
    لجأ الملحدون في حربهم هذه التي لا استسلام فيها مهما انفضحوا : لجأوا للعبة جديدة وهي :
    تشابه الجينات !!!..

    فبالطبع لا يعني أن عدد كروموسومات نبات البطاطا 48 وتساوي عدد كروموسومات الشيمبانزي :
    أنهما متشابهين جينيا ً!!.. لا بالطبع ... ولا يعني حتى أنها قريبة من الإنسان 46 كروموسوم ..
    وذلك لتفاوت طول وعدد جينات كل ٍمن كروموسومات نبات البطاطا : والإنسان أو الشيمبانزي بالمقابل !!..
    ولكن :
    أرادوا أن يبرهنوا على التقارب بين جينات الإنسان والشيمبانزي أكثر وأكثر ...
    فماذا فعلوا ؟!!!..

    لجأوا إلى خدعتين ...
    الأولى - وهي ليست أصل موضوعنا الآن ولكن سنذكرها - :
    وهي ادعاءهم تشابه جينات الإنسان والشيمبانزي بنسبة 98.5 % !!!!..
    وهذا الإعلان وحده - وعلى عموميته هكذا - كفيل بخداع وبلبلة أي أحد من محاربي التطور !!!..
    ولكن : هل يعني ادعاؤهم ذلك أي شيء بالفعل على أرض الواقع علميا ً؟!!!..

    نقول ...
    أولا ًتشترك الكائنات الحية في الكثير جدا ًمن الصفات الحيوية .. مما يجعل نسبة تشابه كبيرة في الجينات - فالغزال فعلا ًيلد مثلنا ويأكل ويتنفس ويجري وله قلب وله معدة ورئتين إلخ - ومن الجهة الأخرى : فعدد كبير جدا ًمن جينات الحمض النووي : لها وظائف متشابههة في انقسام الحمض النووي ونسخه وترجمته لبروتينات إلخ .. وهي وظائف واحدة في كل الكائنات الحية أيضا ً!!!.. وهي التي كانوا يسمون معظمها من قبل جانك جين : أي جينات بلا فائدة : عندما لم يكونوا اكتشفوا وظائفها بعد !..
    فهذا كله يجعل بالفعل : تقارب كبير بين جينات الكائنات الحية ...

    ولكن ... لماذا الإنسان والشيمبانزي بالذات أعلنوا عنهما هذه النتيجة الغريبة ؟!!..
    وهل بالفعل تلك النسبة الـ 98.5 % : هي لكل جينات الإنسان والشيمبانزي ؟؟.. أم جزء منها فقط ؟!!..

    4...
    نقول (وكما نقل لنا الدكتور السرداب جزاه الله خيرا ً) :
    في عام 1987 قام عالمان داروينيان وهما : سيبلي Sibley و : ألكوست Ahlquist :
    بدراسة 30-40 حمض أميني في الشمبانزي : ومقارنتها بتلك الموجودة في الإنسان ..
    ثم خرجوا بنتيجتهما المتحيزة - والتي لم تتزعزع من ساعتها إلى اليوم في الأوساط الداروينية والإلحادية - :
    وهي أن نسبة التشابه في الجينـات بين الإنسان والشيمبانزي هي 98.5 % !!!..
    ثم قاما بنشر بحثهما في مجلة داروينية شهيرة !!!..
    Sibley and Ahlquist, Journal of Molecular Evolution, vol. 26, pp. 99-121

    لكن المثير للجدل في هذا الأمر : هو أن تلك الدراسة قديمة منذ عام 1987 :
    ولم يكن أحد بعد قد استطاع رسم خريطة الجينوم البشري بأكمله والتي لم تنته إلا 2001 !!..
    فعلى ماذا خرجوا بهذا التعميم من تشابه (( جينات )) البشر والشيمبانزي بـ 98.5 % ؟!!..
    وخصوصا ًوأن علماؤهم كانوا يقولون أن المناطق التي تحتلها الجينات على شريط الـ DNA :
    هي 5 % فقط !!.. وباقي الـ 95 % كانوا يصفونها بالجانك جين أي جينات متخلفة من التطور :
    ثم اتضح أن لها وظائف هامة جدا ًكما وضحنا هنا :
    http://abohobelah.blogspot.com/2012/06/6_7828.html

    ثم :
    وما هي نسبة 30 أو 40 .. إلى 100 ألف حمض أميني أو بروتين في خلية الإنسان !!!..
    بمعنى آخر : نسبة ما قاموا بمقارنته هو 1 : 2500 !!!!!!!!!!!!!!!!!!!..
    وهو ما لا يتم ذكره لدى الملاحدة ومروجي التطور عند إعلانهم هذا الخبر الساحق الماحق :
    نسبة تشابه جينات الإنسان والشيمبانزي : 98.5 % !!!..
    < دوما ًهم يتفننون في صنع أخبار الاكتشافات والأبحاث وعناوينها الخادعة كما رأينا من قبل >

    وليس هذا فقط .. بل إن التجربة التي استخدمها العالمان : هي تجربة قليلة الاستخدام أصلا ًومثيرة للجدل !!.. ألا وهي تجربة الـ DNA التخليطي !!..
    وقد قام أحد العلماء ويدعى ساريش Sarich : بإستخدام نفس التجربة على نفس البروتينات التي قام بها العالمان : واكتشف أن مصداقية أبحاثهم مثيرة للجدل هي الأخرى !!.. وأن البيانات مبالغ فيها إلى حد كبير !!!.. وأن نسبة التشابه أقل من ذلك بكثير !!!..
    Sarich et al. 1989. Cladistics 5:3-32

    < تذكروا : كل علماء التطور والملاحدة : كذبة أو مخادعين إلا مَن طلب منهم الحق : مثال :
    http://abohobelah.blogspot.com/2012/06/blog-post.html

    ومسألة المقارنة على أساس البروتينات والأحماض الأمينية أصلا ًلا ترمز إلى شيء حقيقة ًيفيد التطور !!.. لأنه من الطبيعي كما قلت من قبل أن يكون هناك نسبة تشابه كبيرة بين الكائنات : وخصوصا ًلتتكامل السلاسل الغذائية !!!..
    فنسبة التشابه بين الإنسان والدجاج مثلا ًكبيرة : من بحث لجامعة كامبردج !!!..
    New Scientist, v. 103, 16 August 1984, p. 19

    ونسبة التشابه بين الإنسان وديدان النيماتود nematode تصل إلى 75% !!!..
    وهذا حتما لا يعني أن 75% من جسد الإنسان مطابق للديدان طبعا ً!!!.. ولا يقول بذلك عاقل !!..
    New Scientist, 15 May 1999, p. 27

    وكذلك نسبة التشابه بين الإنسان وذبابة الفاكهة 60% !!!..
    Hürriyet daily, 24 February 2000

    وفي مجلة SCIENTIFIC AMERICAN الداروينية الشهيرة عدد ديسمبر 2009 :
    وفي مقال بعنوان : ما الذي يجعلنـا بشرا what makes us human ؟!!..
    حيث قامت الباحثة كاتبة المقال بدراسة متوالية DNA في أحد الجينـات ويُطلق عليه HAR1 ..
    وقامت بدراسة هذا الجين في كل من الإنسان والشمبانزي والدجاج .. وعدد قواعده النيتروجينية 118 قاعدة ..
    فاكتشفت أنه حسب النتائج :
    فإن الدجاج - ومن المفترض طالما كانت المسألة بالشبه !! - فإنه أقرب للشيمبانزي من الإنسان !
    حيث الاختلاف في متوالية للـ DNA الـ 118 بين الشمبانزي والدجاج : 2 فقط !
    وأما بين الدجاج والإنسان : 18 !!!..



    وهذا إن دل على شيء كما قلنا : فيدل على أن هذا الطريق هو الآخر :
    مسدوووووووووووووووود !!!..

    فهل استسلموا ؟!!!..

    5...
    بالطبع الإجابة معروفة .. فمسألة التطور بالنسبة لهؤلاء القوم :
    هي أيدلوجية يقوم عليها إنكار الإله في العصر الحديث تحت عباءة مزورة للعلم !!!..

    فماذا كان ؟!!!..

    لقد رجعوا لمسألة كروموسومات الإنسان والشيمبانزي من جديد ...
    ودأبوا للبحث فيها للخروج بحُجة جديدة : تساند مزاعمهم في التطور !!!..
    ورغم أن علماؤهم حتى الآن - لاسيما البيولوجيين منهم - :
    لا زالوا يتخبطون في محاولة تفسير كيفية ظهور طفرات كبيرة بالصورة التي تنتج للكائن أعضاء جديدة ومهيأة تماما ًلوظيفتها في بيئته :
    إلا أنهم افتروا هذه المرة فرية كبيرة !!!..
    ما كانوا ليتجرأوا عليها إلا مستغلين جمود فكر أتباعهم عن البحث والاعتراض !!..
    فضلا ًعن ندرة التخصص الذي يتحدثون فيه (عالم الـ DNA) بين العوام !!!..
    فماذا كان مخرجهم الذي يتشبثون به ويبثونه في كلامهم ومواقعهم وحتى في الويكيبديا للأسف ؟

    6...
    في الرابط التالي الذي يشير إليه الملاحدة والتطوريون كثيرا ً:
    معلومات عن أحد كروموسومات الإنسان : حيث قامت الويكيبديا بعرض نبذة عن كل كروموسوم :
    وهذا الذي ربطوه بالتطور : هو الكروموسوم رقم 2 هنا :
    http://en.wikipedia.org/wiki/Chromosome_2_(human)

    حيث أفردوا له - وكعادتهم في الويكيبديا - فقرة كاملة عن علاقته بالتطور !!!..

    حيث يقولون أن عدد كروموسومات الشيمبانزي الـ 48 مثل سلف الإنسان المزعوم :
    قد التحم منها كروموسومان ( كده بقدرة قادر ) أثناء تطور الإنسان خصوصا ً:
    ليصبح عدد كرومسومات الإنسان 46 فقط !!!!..

    فيتحدثون عن ذلك بكل بساطة : وكأن مسألة فك والتحام كرومسومات الـ DNA هذه :
    هي في مثل سهولة عملية لحام الحديد أو المعادن !

    والواقع :
    أن أي نظر في عالم الـ DNA - وكما سنفعل الآن - : هو ينزع من أي إنسان اعترافا ًيقينيا ًبأنه هناك : فاعل مدبر خالق حكيم : هو الذي يهدي هذه المكونات المتناهية في الصغر والتعقيد والنظام : إلى عملها الكامل وكما هو مخطط له ...!!
    وكما أشرت هنا مثلا ً:
    http://abohobelah.blogspot.com/2012/06/6_8870.html

    ولنبدأ معي الآن - وكعادتي في حبي لإظهار إعجاز خلق الله قبل وأثناء الرد على الشبهة -
    فأقول ...

    1)) تعقيد الـ DNA كمركب بروتيني ...

    يتركب الحمض النووي من 4 قواعد نيتروجينية وهي :
    الثايمين T ولا يرتبط إلا بالأدنين A ..
    والسايتوسين C ولا يتربط إلا بالجوانين G
    وتترتب هذه القواعد على جانبي الشريط النووي الطويل في شكل تتابعات متقابلة (نيوكليدات) مثل :
    CATTGTCATTGGCTATGCCATGCTTTGACGTGAGG
    وهكذا .. حيث تكون كل ثلاثة منها شيفرة وراثية من شيفرات الجين ...



    وتحتوي كروموسومات خلية الإنسان عدد 3.2 مليار نيوكليدة !
    وكل ثلاث متتابعات كما قلنا : يمثلون شيفرة وراثية من شيفرات الجين : لتكوين بروتين معين ..
    ويؤدي التغير العشوائي في متتابعة هذه الشيفرة إلى أثر يكون مؤذي ومرضي ..
    مثل تغيير المتتابعة (CTC) إلى (CAC) : في الشيفرة الوراثية السادسة : والمسؤولة عن تركيب السلسلة بيتا من خضاب الدم : فينتج مرض فقر الدم لتغير البروتين الناتج : فتظهر بسبب ذلك كريات دم قابلة للتمنجل (فقر الدم المنجلي) ..
    وكل مجموعة كبيرة من هذه الشيفرات الوراثية : تعطي جينا ًكما قلنا يختلف طوله بمستوى تعقيده ..!
    < يحوي الكرومسوم الواحد : من مئات إلى آلاف الجينات على حسب طوله >

    وأما الإعجاز في لف كل هذه الكروموسومات الدقيقة داخل نواة الخلية الواحدة من جسم الإنسان :
    فانظروا معي للإبهار التالي :
    ويا ليت تبدأوا معي من أسفل الصورة إلى أعلاها ..
    حيث نبدأ في الأسفل بصورة حقيقية لكرومسوم على اليمين : وأخرى مرسومة بسيطة على اليسار ..
    ثم يتم أخذ مربع صغير من الصورة التي على اليسار لتكبيره لبيان تعقيده ...!
    ثم يتم أخذ مربع منه لتكبيره أيضا ً: وبيان التفافه على الهستونات المكورة كما في الصورة ..!
    ثم تكبيرها بمربع آخر ..
    ثم أخذ مربع صغير منها لتكبيره : لنحصل أخيرا ًعلى شريط الحمض النووي من النيوكليدات !
    فسبحان الله العظيم على مَن يصف كل ذلك بالصدفة والتطور : أخزاهم الله !



    7...
    والآن نرجع لأصل الشبهة .. ومن موقع الويكيبديا ..
    حيث أوردوا الصورة التالية : لتوضيح تخيلهم لالتحام زوج الكروموسوم المزعوم :



    فماذا نرى في الصورة أعلاه ؟؟؟..
    الشكل على اليمين :
    نرى تخيلهم لكرومسومين للشيمبانزي : وقد التحما معا ًفي الكرومسوم 2 للإنسان !
    وأما دلالتهم المتوهمة على ذلك : فهي وجود هذه البقايا الزرقاء والحمراء في الكرومسوم 2 :
    حيث يشرحها المستطيل الذي على اليسار :
    بأن اللون الأزرق :
    يرمز إلى السنترومير : وهو الجزء من الكروموسوم الذي يربط نصفيه الكروماتيدتين معا ً..
    وهو الذي يسبب الاختناق والضيق في منتصف شكل الكرومسوم ويعطيه شكل X المميز ..
    وأما اللون الأحمر :
    فيرمز إلى التيلوميرات .. وهي غطاء غلق أطراف الكرومسوم في نهايتي كل كروماتيدة ..
    ويشبهها العلماء بالقطعة المعدنية في نهاية رباط الحذاء لحمايته ..
    وإليكم الصورة التالية فيها شرح أكبر للسنترومير والتيلوميرات وغيرها في الكروموتيدة الواحدة :



    حيث نرى في الصورة أعلاه : ثلاثة أنواع من تراتيب النيوكليدات المميزة والهامة وهي :

    1))
    مناشئ التضاعف :Replication Origins of ..

    وهي التتابعات النيوكليوتيديه المميزة التي يبدأ من عندها عملية تضاعف الـ DNA

    2))
    السنتروميرات Centromeres ..

    (وهي مربط الفرس لدينا هنا هي والتيلوميرات فأرجو التركيز) ..
    وهي تتابعات نيوكليوتيدية تتوسط الكروموسومات : وهي عالية التكرار وشديدة التعقيد :
    وهي التي تشد كل كروماتيدة للداخل لتعطي الشكل المميز X للكروموسوم كما قلنا ..
    وتتجسد واحدة من أكبر مهمام السنترومير أثناء انقسام الخلية والانعزال الدقيق للكروموسومات خلال الانقسام النووي (الميتوزي والميوزي)
    ولذلك لو لاحظتم في الصورة أعلاه : ستشاهدون شيئا ًمرتبطا ًبالسنترومير وهو :
    >>>
    بروتين الكينيتوكور Kinetochore proteine ..
    وهو مجموعة من البروتينات الخلوية التي ترتبط بالسنترومير خلال الانقسام النووي (الميتوزي والميوزي) ..

    >>>>

    وأما الذي يريد أن يرى جزءا ًمن الإبهار بعينيه ليقول :
    سبحان الخالق : وما أغبى الملاحدة والتطوريين : فلينظر معي لمقاطع الفيديو التالية :

    فهذا فيديو توضيحي لعملية الانقسام ودور السنترومير في ارتباط خيوط المغزل به وشد الكروموسومات :



    وهذا فيديو آخر أطول وأكثر احترافية لأنه يعرض أطوارا ًأخرى أيضا ًغير الانقسام ..
    وأعتذر عن الموسيقى ولكنه يستحق المشاهدة ...



    والخلاصة نقول :
    السنترومير : هو النقطة التي يتم مسك الكروموسوم منها بخيوط مغزل الخلية : للتوجيه الحركي لكل كروموسوم : للاصطفاف مع الآخرين وسط الخلية قبل الانقسام والفصل !!!.. وإليكم هذا الفيديو الأخير يشرح المسألة بصورة أكاديمية مبسطة ومفصلة لمَن يفهم اللغة الإنجليزية :



    والسؤال الآن لكل مَن لا زال يصدق خرافات التطور :
    هل يبدو هذا السنترومير هو من الأشياء التي يسهل تكرارها داخل الكروماتيد الواحد وكما يدعون في كروموسوم 2 في الإنسان ؟!!..
    هل تخدعكم هذه الافتراضات الساذجة - كالمعتاد - للتطوريين ورسمتهم هذه في الويكيبديا :



    هل تصدقون تعليقاتهم عليها : وبعد كل ما شاهدتموه من قمة في التخطيط (أو الهداية الربانية كما نسميها) والنظام والترتيب والتعقيد في كل جزء وتكاملهم جميعا ًلغايات وأهداف محددة ؟!!..
    بل ...
    هل تعلمون أن منطقة هذا السنترومير هي من أعقد البروتينات في الكرومسوم ومن أكثر أعداد تتابعاته تكرارا ً..
    وانظروا معي للصورة التالية :
    ويظهر فيها بجلاء شدة تعقيد السنترومير في الوسط أو التيلوميرين في الأطراف :



    فهل من العقل أن يُقال أن هناك (( بقايا )) سنترومير في الكرومسوم 2 في الإنسان ؟!
    هل يوجد تعقيد في تلك (( البقايا )) مثلا مثل تعقيد السنترومير الأصلي الموجود به فعلا ً؟!!..
    هل الخلية تتخبط وتتلخبط في إرسال خيوطها المغزلية مثلا ًعند انفصال الكرومسومات :
    فتمسك بهذه (البقايا) بدلا ًمن السنتروميرات الأصلية ؟!!..
    أم هل يوجد عند هذه (البقايا) بروتين الكينيتوكور : وكما في السنترومير الحقيقي ؟!!..
    أم أن الأمر مجرد (( تشابه ظاهري )) كعادة التطوريين والملاحدة دوما ً:
    حيث وجدوا تشابها ًبين مجموعة متتابعات في الكرومسوم 2 : ومتتابعات السنترومير المتكررة ؟!!..
    والله المستعان ...!

    وأما التيلومير .. فالأمر أعقد وأغرب !!!.. وأعجز للملاحدة ؟!!..
    لأنه الجزء الخاص في الكروموسومات أصلا ًلحمايتها من الإلتحام !!!.. فهذه من أبرز وظائفه !

    4))
    التيلوميرات : Telomeres ..
    فالتيلوميرات هي تتابعات متخصصة من الـ DNA توجد عند نهايتي كل كروماتيدة في الكروموسوم ..
    < يعني 2 في الكروماتيدة الواحدة عند طرفيها - 4 في الكروموسوم الواحد >
    ولهذه التتابعات عدة وظائف منها (وأرجو الانتباه الشديد) :

    1-
    تسهيل عملية تضاعف نهايات الكروموسومات : وضمان عدم قصرها عند كل دورة تضاعف ..
    2-
    منع التحام نهايات الكروماتيدات مع بعضها البعض أثناء الانقسام (وهذه هامة جدا ً) !
    3-
    منع الإنزيمات المحللة للدنا من تكسير نهايات الكروماتيدة ..

    ولكي أختصر عليكم الفهم .. وفي ضوء ما تم منحه من جائزة نوبل عام 2009م لثلاثة باحثين ودكاترة بخصوص وظيفة هذه التيلوميرات وإنزيمها : وبخصوص أيضا ًأحدث النتائج عام 2011 :
    فهذه التيلوميرات : تعتبر المؤشر الأبرز اليوم على عمر الخلايا وعمر الإنسان بالتالي !!..
    وسأقوم بتيسير الفهم عليكم أكثر ...

    فهذه التيلوميرات في نهاية الكروماتيدات : لها تتابع طويل ...
    ومع كل عملية تضاعف في كرومسومات الخلية : تفقد هذه التيلوميرات من طولها ..
    حتى تصل إلى حد معين من القصر : لا تستطيع معه حماية الكروماتيد عندها .. فيبدأ موت الخلايا أو نهايتها !
    ومن هنا يستطيع العلماء النظر في طول هذه التيلوميرات : ومقارنتها بعمر الإنسان !!..

    فالطفل مثلا ً: تكون التيلوميرات في نهايات كرومسوماته طويلة ..
    وكلما تقدم به العمر : تزداد قصرا ً...

    < حيث في الخلايا الجسدية العادية : يتم فقد طول معين من تتابعات التيلوميرات عند كل تضاعف :
    وأما في الخلايا الجنسية : فلا !!.. وذلك ليولد الجنين بتيلوميراته كاملة كما هو مفترض !!..
    فسبحان مدبر كل شيء وهاديه
    > !!!..

    وهذا لا يعني أن العلماء يستطيعون الآن أن يحددوا عمر الإنسان .. لا ..!
    وإنما مثلا ًإذا رأوا تلك النهايات (أي التيلوميرات) قصيرة عند طفل وعلى عكس المفترض :
    فيعرفون أن عمره لن يطول .. لأنه لن يلبث طويلا ًحتى تنتهي خلاياه ...
    وكذلك لو كان هناك رجل أو شاب : طول تيلوميراته أقصر من المفترض لمثل سنه :
    يُعلم أن هناك قصر في عمره ... وهكذا ...

    ولقد بدأت بعض الشركات عالميا ًبالفعل في تقديم هذا الاختبار النووي .. ولكن تكلفتها لا زالت كبيرة الآن .. ويتوقعون مع زيادة الإقبال عليها وانتشارها - وخصوصا ًمن شركات التأمين على الحياة المحرم شرعا ً- أن تقل تكلفتها ...

    وإليكم هذا الفيديو التوضيحي القصير عن التيلوميرات وإنزيمها لحماية أطراف الكرومسومات .. وقصرها مع كل عملية تضاعف :



    وهذا فيديو آخر أكثر طولا ًوشرحا ًوتفصيلا ًولكن لمَن يفهم اللغة الإنجليزية :



    فموضوع التيلوميرات طويل ومعقد وهام جدا ًعندما فكر العلماء في استغلاله !!..
    وخصوصا ًللتحكم في تضاعف الخلايا السرطانية مثلا ً!!!..
    وكما ستشاهدون أو تقرأون في الفيديو أعلاه ...
    ----------

    وأخيرا ً....
    هل ما زلتم ترون أية حيادية في بقاء هذه الكذبة الإلحادية والتطورية في موقع الويكيبديا عن الالتحام المزعوم في الكرومسوم 2 : والتي تم وضعها فيما يبدو منذ سنوات : وقبل هذا التداعي المتسارع في الاكتشافات المتعلقة بالتيلوميرات وغيرها ؟!!!..

    تلك التيلوميرات الموجودة أصلا ًلـ (( منع التحام )) نهايات الكروموسومات بعضها ببعض !!..
    فتصبح عند التطوريين والملاحدة ( وبقدرة قادر ) : تسمح بهذا الإلتحام بل : وتقبع بقاياها بداخله !!!..

    فإذا قال أحدهم أن هناك نقطة أخرى وهي قولهم أن هذا الكرومسوم 2 في الإنسان : يتشابه بالفعل جينيا ًمع كروموسومين من الشيمبانزي : لقلنا : هات الدليل الرسمي بالتتابعات الجينية ؟!!!.. لأن مثل هذا القول الجزافي : يصعب قوله هكذا بغير تحقق أصلا ً!!..
    وذلك لأن معظم أبحاث المقارنات : تتم أساسا ًعلى أجزاء صغيرة من الكرومسوم وليس كله !!..
    < فجينوم الشيمبانزي لم يتم رسم خريطته كله بعد مثل الإنسان والذي أخذ سنوات طويلة ! >

    ثم :
    وهل ما زال أحد يصدق أن الاختلاف بين الإنسان والشيمبانزي :
    هو فقط بهذه التفاهة الصغيرة ؟!!..
    وهل لو قمنا معمليا ًبعمل ذلك الالتحام لكروموسومي الشيمبانزي : هل سيصير أقرب للإنسان مثلا ً؟!
    هل ما زال أحد يصدق هذه الخرافات بغير تعقل !!!..

    أقول ذلك إخواني والله : من غمي وحزني على الإنسان عندما يبيع عقله للجهل والأوهام !!..
    لأن المضحك المبكي والذي أختم به حقا ًمعكم الآن :
    فهو أن الطفرات في الجينات فقط بل وفي أصغر شيفراتها الوراثية : تؤدي لاختلالات وأمراض !
    فما بالنا بنقص كروموسوم بأكمله !!!.. أو زيادته !!.. أو التحامه بغيره - بفرض إمكانيته أصلا ً- !
    أقول :
    لقد أعطانا الله تعالى الجواب على ذلك في شكل تشوهات العيوب الولادية لمثل تلك الحالات !!!..
    فهل تعرفونها ؟؟؟؟..
    < سأضع بين قوسين رقم الكروموسومات الزائد أو الناقص عن العدد المفترض للإنسان وهو 46 >

    تشوهات متلازمة إدوارد Edward Syndrome : بسبب نسخة زائدة من الكروموسوم 18 (47) !!!..
    تشوهات متلازمة داون Down Syndrome : بسبب نسخة زائدة من الكروموسوم 21 (47) !!!..
    تشوهات متلازمة باتاو Patau Syndrome : بسبب نسخة زائدة من الكروموسوم 13 (47) !!!..
    تشوهات متلازمة تيرنر Turner Syndrome : بسبب نقص كروموسوم (X) للأنثى (45) !!!..
    تشوهات متلازمة كلينفلتر Klinefelter syndrome : زيادة كروموسوم (X) للرجال (47) !

    وأما باقي تشوهات المتلازمات الناتجة عن طفرات أو نقص في الجينات :
    فيمكن معرفة معلومات عن أغلبهم من الرابط التالي :
    http://www.caihand.org/amm.htm

    وأعتذر عن أي خطأ كتابي في المصطلحات لاجتهادي لعدم التخصص ..
    ولكني آمل أني وضحت لكم ما يفيدكم في فهم ألاعيب التطوريين ...
    ويمكن أن تفيدنا الأخت طالبة علم وتقوى من واقع تخصصها في الييولوجيا الجزيئية بما يفيدنا أيضا ً..
    أو تصحح لي خطأ أو تعيد توجيهه علميا ً...

    والله المستعان ...

    التعديل الأخير تم 10-08-2012 الساعة 02:10 PM

  12. #132

    افتراضي

    الأخ الغالي أبو حب الله مجهود جبار وهائل قمت به لدحض هذه الشبهة أسال الله أن يكتب لك الأجر والمثوبة
    وأنا أقف هنا عاجزا عن شكرك فقد أزلت بهذا المجهود الجبار الغشاوة التي قد تعمي أعين الكثير من غير المتخصصين
    في هذا العلم بسبب ما يطرح من الشبه على العوام .
    تقبل خالص الود والتقدير

  13. Arrow

    ماهذا أستاذي أبوحب الله

    ماقمت به من جهد ليس بالأمر الطبيعي

    فكيف نستطيع أن نعبر لك عن امتناننا وفخرنا بك

    لقد أجبت عن الكثير من الإشكالات التي كانت عالقة في ذهني فأنا لا أثق بما يقوله الملاحدة

    والحمدلله أن وجدت مثلك والأخت الفاضلة طالبة علم ممن نستطيع الإعتماد عليهم بعد الله

    بكل ما ينتابنا من غوامض هذا العلم

    من القلب شكرا أيها الرائعون

    ومن القلب دعوة خالصة أن يجعلكم من أصحاب اليمين وجنات النعيم

    استمروا فالعالم الإسلامي بحاجتكم

    بعد إذنك أستاذي احبيب بإضافة بعض ماكتبت إلى صفحتي

    إلا على فكرة أين ذهب صاحب الموضوع

  14. #134

    افتراضي

    جزاكم الله خيرا ًإخواني الأفاضل ...
    وأفضل ما يعود علي والله هو دعاؤكم لي ...
    فاللهم استجب ...
    التعديل الأخير تم 08-29-2012 الساعة 10:39 PM

  15. #135

    افتراضي


    متفرقات ...
    بعض روابط الموضوع لكشف كذب وخداع وتدليس التطوريين في أدلتهم ..

    الأخوة الكرام ...
    أعلم أن المشاركات المتعلقة بالتصميم الذكي كما وعدتكم تأخرت .. ولكن والله ما باليد حيلة ..
    هو الانشغال وضيق الوقت << عدوي اللدود ... وإلى أن تحين فرصة الكتابة :
    سأنقل لكم إجابة شبهتين يظهر فيهما كذب وتدليس التطوريين من جديد ..
    الأولى بخصوص العصب الحنجري وخاصة ًفي الزرافة ..
    والثانية بخصوص التطور المزعوم لإحدى سحالي أوروبا (سحلية الحائط الإيطالية) ..

    ولكن قبل البدء في عرض الرد على الشبهتين ...
    سأستعرض معكم أولا ًنصيحتي لأحد المنخدعين بهؤلاء القوم الكذابين - أكثرهم ملاحدة - ..
    حيث قلت له :
    -----------

    بداية ًزميلي :
    أدعو الله عز وجل أن تكون ممَن يبحثون عن الحق فعلا ًولست متصفا ًبالعناد ولا الهوى ...
    فإن كنت كذلك : فأبشر بالخير إن شاء الله ...

    وكعادتي في كل رد :
    سأضع الرد في نقاط متسلسلة لسهولة قراءته ومتابعته ...
    فأقول والله المستعان :

    1...
    الذي يعلم بأن التطوريين مجموعة من الكذابين والمخادعين : فالمفترض ألا يثق بهم .. ولا بعروضهم التليفزيونية ومجلاتهم العلمية إلخ ..
    فما أسرع ما يدندنون حوله اليوم : ثم تنفضح كذباتهم غدا ً!!!..
    وإن كنت لا تعلم مدى جرأتهم على الكذب وغش الناس والعوام وانعدام أمانتهم العلمية في ذلك - وهي علامات الباطل وإلا ما كانوا لجأوا لكل هذه الحيل - : فإن كنت لا تعلم ذلك : ولم تقرأ عنه من قبل :
    فإليك هذه الروابط فيها عشرات من أنواع الكذب الذي يتغذون عليه ولا حياة لنظريتهم وانطلاءً لها على العوام بدونه :

    لماذا يكذب التطوريون دوما ً؟؟
    http://abohobelah.blogspot.com/2012/06/4.html

    كيف انتقلت الأسماك إلى البر (ومعها فضيحة أكذوبة سمكة الكوالاكينت) :
    http://abohobelah.blogspot.com/2012/06/5.html

    أكاذيب إمكانية تطور الإنسان من سلف أشبه بالقرود :
    http://abohobelah.blogspot.com/2012/06/1.html

    أكذوبة تطور الجنين البشري مرورا ًبمراحل تطوره في الرحم !!..
    http://abohobelah.blogspot.com/2012/06/blog-post.html

    فضائح أكاذيبهم في إيجادهم حفريات أصل الإنسان أو الحلقات الانتقالية :
    http://abohobelah.blogspot.com/2012/...g-post_20.html

    تفريغ فيلم المطرودون الذي فضح تكميم الأفواه في الخارج لكل مَن ينتقد التطور من دكاترة الجامعات :
    http://abohobelah.blogspot.com/2012/06/6_4265.html

    فضائح أكاذيبهم وفي مجلاتهم العلمية عن تطور الطيور من الديناصورات !
    http://abohobelah.blogspot.com/2012/06/6_9827.html

    فضائح أكاذيبهم عن تطور الحيتان والدلافين من كائنات برية واعتراف مدير متحفهم بذلك :
    http://abohobelah.blogspot.com/2012/06/6_9100.html
    وهذا معه :
    http://abohobelah.blogspot.com/2012/...g-post_21.html

    أكذوبة أن التهجين هو التطور الأصغر ويمكن أن يؤدي إلى تطور أكبر :
    http://abohobelah.blogspot.com/2012/06/6_4690.html

    أكذوبة الأعضاء الضامرة : نتوء الأذن :
    http://abohobelah.blogspot.com/2012/06/6_5172.html

    أكذوبة الجينات التي ليس لها فائدة (الجانك جين) :
    http://abohobelah.blogspot.com/2012/06/6_7828.html

    وأيضا ًادعاؤهم أن الريتروفيروس دليل ٌعلى التطور :
    http://abohobelah.blogspot.com/2012/06/6_5712.html

    وادعاءهم وجود بقايا ذيل ضامرة للإنسان :
    http://abohobelah.blogspot.com/2012/06/6_8564.html

    وشبهاتهم في وجود حلمات ثدي لذكور الثدييات والرجال :
    http://abohobelah.blogspot.com/2012/06/6_4900.html

    وادعاؤهم بعدم وجود فائدة لأعين سمك الكهوف :
    http://abohobelah.blogspot.com/2012/06/2_3272.html

    وادعاؤهم عدم وجود فائدة لأجنحة الطيور التي لا تطير :
    http://abohobelah.blogspot.com/2012/06/3_461.html

    وخرافاتهم حول تطور عنق الزرافة :
    http://abohobelah.blogspot.com/2012/...g-post_31.html

    وأخيرا ً: بيان تأثر داروين بالأفكار الخاطئة في عصره وإقامته نظريته عليها :
    http://abohobelah.blogspot.com/2012/...g-post_21.html

    وإليك اختصارا ً: رابط مواضيع التطور بأكملها : يمكنك التجول فيها وقتما تشاء :
    http://abohobelah.blogspot.com/2012/...g-post_28.html

    والله الموفق ...


صفحة 9 من 18 الأولىالأولى ... 7891011 ... الأخيرةالأخيرة

معلومات الموضوع

الأعضاء الذين يشاهدون هذا الموضوع

الذين يشاهدون الموضوع الآن: 1 (0 من الأعضاء و 1 زائر)

المواضيع المتشابهه

  1. ما يجب أن تعرفه عن نظرية التطور ؟
    بواسطة أبو حب الله في المنتدى أبو حب الله
    مشاركات: 8
    آخر مشاركة: 01-01-2014, 01:58 PM
  2. خبر من الجزيرة.نت: والاس وليس داروين واضع نظرية التطور
    بواسطة Almumen في المنتدى قسم الحوار العام
    مشاركات: 4
    آخر مشاركة: 01-21-2013, 03:57 PM
  3. ما يجب أن تعرفه عن نظرية التطور البيولوجي (مجازا: نظرية داروين)
    بواسطة IsamBitar في المنتدى قسم الحوار العام
    مشاركات: 3
    آخر مشاركة: 10-09-2011, 09:59 PM
  4. نظرية التطور ( داروين ) اخر الاخبار.
    بواسطة cemetery في المنتدى قسم الحوار عن المذاهب الفكرية
    مشاركات: 0
    آخر مشاركة: 01-18-2009, 04:02 PM

Bookmarks

ضوابط المشاركة

  • لا تستطيع إضافة مواضيع جديدة
  • لا تستطيع الرد على المواضيع
  • لا تستطيع إرفاق ملفات
  • لا تستطيع تعديل مشاركاتك
  •  
شبكة اصداء